Description :
From Genome Similarity Track
Location :
Scaffold_443:344- 2671
Sequence
2327 bases(100 bases per row)
CTGATCCGACAAGCTGTTCGACTTGCTACCGTATTAAAAACTACCGTCTAAACGTATTTCGAAGGCGATTGGCCAGGTGCTACGACCCAGTACCGTCCGT
AAGATACTAATCTCGTCTAAAAATTGCCAACTGAATCAAGCGGAAACCGGCTCCGACCATCAAGTCTCGGCACAAGGTACTTGAAAGAACCTCCTCGGAT
TGACACGATCTCCGATCGACGTAGGAGGAAGAAGTACGCCAAGCACATCACCCCCCATAAAGCTTGCTCACGTGGTGTAGCCATCGTCAAGCTGCGAAAG
CAGGCTTCCAGAATGTCGAGTGAAACCGGTTCCTTACGAAGCCGCGGTGTATCGAGACGGCTGATACCTTTGAGAAGCATGCGGATGTCTGGGTGTGCGA
TCGGGAAGTCGTAATTGAAAGCGGCGAAAAAGTGTCGTACGCCTTGAAGAACCGCTGCAATGGAATCACTACGGATTGGACCGCCGGATCCGAAGCCGAA
CTGAAAGCCGTGGAGAACGAAATCTGAAATATACTGCACTTTCCGATGAATGGAGACGTCGAGAAGATATGGGTGAGCGCCTCTGCGTGAGATCCAACTG
GTCCACTTGCCTAGGGATCGACTGTACTGCACAAATGTGGAGTCGGCAACGGAGTGCGCGCGGAGATACACTGCTAGACGCTGGTTAGGCTTTGTATATC
CACCGGCGGGGACACCTGCAATCAGCCGGAAGTTAGCGACGTAAAAAGATCCACAAACGACGCGTTAGCGGTAAGTCGGGAGCCAGCATCTGCTCGGACG
TTGTCTGCGTCGGGTATGTGGGACGCAGAGAGCCACGGTCGAAAAGTTGATTCCCACCAACTTAGCAGGCGAATAAGAACTTGAGCCCTGGGATTGCGAG
ATGCCAATTTGTTCTGCCACGCGACGGCAGATGTGTTGTCGATGCGGAAGTGTACGTGCCGCGGCCTCCCAGTAATGCGAGCGTTTGAAGCCCACCTTGC
GCCCCATGTATGCACAGCGAAAGCACACGAGAGAAGCTCGCGGAAGTTGATGTCAAAACCTTTGTCTCTCCGTTGTTGAACGCCGCGATGAGATCACGCT
CGGACAGAGTGAATTGGTACGTCAGTGCCTCCTTCGCGGATATGTCAAGTGCGCAGAGACCGAAATCTGAAGCATCCGTTTCAACCACAATGTCCGGAGG
CGGAAGTGCGTTGAAATACGCTAGCGAAACGCCGTTCAGGTGAGGGGTGCGCAAAATCATCCACCACCACAGTAGGTCATCCTTCATTGTAGAAGTCACG
GGGACGCTCTGGAAGCGGTTGAGCCGAGCCTCGCGGACCCGTATGCGCTGTAAAAATGGTCTAGCGGCCCGAATACATGTTGCCACATGGCGTAGACTTC
CGAGCAGGAACCGGTACCCCTTGCGGGTGAGTGAACTTGCGACGTAGGCGGAAGCTACGATTTTGCGGGCTTTGTCGATTTTGGCTGAAGGCATTGCAAC
AATTTCTGCGATTGTATCGAACTCGAGTCCTAGAACGCGCTGGCGCGTCTTCCAGGGAGTAATCTTCTCAGTGTTGATAGCATCGACACCCAGGACGGCG
ACCATGGCAAAACGGAGAGAACGATCCATGTCAACGCATGTGGTGTCAATGTCGGCAGCCACGTTAATGTGATCGTCTACCCAGTGATAGTTGAAGAAGC
CACCAGGAGAAACTGCATTCGAATGACCGCCGTGAATATGAGAGATCGCTCCGCCAAATATCTCGTAAAAGCCGGGAGATTCCGTCCAACCGAAAAGGTG
CTGATAACTCGATGATCTATGCGTTTCTTCTTTGATAAGACCGGCAAACAAGTACACACTGTTGCTGTGGATGCTGATGTGGCGGAAGGCAGATGCCACG
TCAGCTGCCATTACACGGACAACCGCACTTGGAAAATCTTCTTTCGTTTTCAAAATTGCTCGCGCTACGGCATCGCAGTGGTGTAGTCCGGCTTAGTAAT
GCTGTTTTGGTCCGTGTAGTCGTTGATCAAAGTACCATCCGGGTTATATATAGTCGTGGAATTGTGCGACCCCTACGTGGTTGGGCATCCTTCGCTTCTC
TTGTCCGACGATCGCCGAACCGAAACTTAATAATTAATTCGGGTCTCCTGCTCATGCATAATCAATGGTCTAAGAAACCAAGCATCTTCCAAGGCGGTCT
TGGGTTCTTTTCCGATAATTCCTTGTCCTAAAAATATTGGACTCCTTTCTTTGAACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNN