Description :
From Genome Similarity Track
Location :
Scaffold_423:344- 1871
Transcript NameFunction/comments
Pytve_DAOMBR484fgenesh-pve_contig_423-abinit-gene-0.34Amino Acid/Auxin Permease (AAAP) Family

Sequence
1527 bases(100 bases per row)
CCAACAAACGCCTAGTTGGTCGAGTTGCTACGGATGTAGTACGGCGTCTCCTGGTACTCGGCCGGGCAGTACTTGAACGTGGCCTCGTCGTCCGAGGGCG
TAAAGAGGTCCTTGCCGGCGATGATGAGCGCGTAGAGGCCGCACAGGAAGCAAATAACGATGATCAGCGACGCGCCGACCTTCTCGTACTTGGGAATGTT
GCGCCAGAACACCTTCAGGTACATGATCGTCGGCATGATCAGGCAGCTCGTCGTGTGCGCGGTGGCACCCGTGAAGTCCTGCAGGTCGAGGTACTTGTCG
CGCAGCGCAACGCCGATGGCGACGAGGATGAGGATGATGACGATGCGCAGGCCGACGTAGCGCATGACATTGCGCGAACCCTCGTACTCGGACAGGCTGT
AGTCGTTGTGCTCCGGCTCCTGCTCCTCGCTCTGGTCCATGCCGCTCTCGAGCGCGCCGTGGCTGGTGCTCGTCACGGAGCCGCGCGAAATCTCCATCGG
CGTCGAGCTCAGCACGTACGAGCGCTTCTCCTGGAGCTCCTCGTCCTGGTCGTCCACGGTGAACGTCGGGTTGGTCGTCTTGTGCATGCCGAGGATCAGA
CGCTCAGCCATGTAGAACGGCGGCTGCAGCAGCGTCGAGAAGGCGATCGTGATGTGCACCTGCATGAAGAGGTAGGCCATGATGACGGCGCCGCGGCTGG
CAGTGAAACCGAGCGGAGAGACACCAGTCGGGTTGTCCGTGTCGACGAACGAGTAGAGCAGGTTGCCCGAGAGCTGGCAGCCTCCGGCAGTGTAGCCCGT
CACAGCGATGACGACGAAGAAGATGGAGATGACGACAATGGTGATCATGACGACGTTGGGCATGCGCTGCGGCTGCGGGTGCTCGCGGTGGAGGTCAGGG
ACGACAATGGCAGCGCCGTATGCCAGCGCCAGACTGCCGAACGACTGGAGCACCTGGCCGAGCGAAATGTCCGGCGACGGGATCGTCGGGTGGCCGCGCA
TCTCGTACTGAAGAATCGAGATACCGATGATGTCAGCGATGACTGTTCCCATGCAGCCAGCGAACGCCATGGCGGCGCCTTCCTTGAGCGTCGGGATGAG
GCACACGGGGAGCACCGTGATGGCCATGAAGAACATCCAGTAGATCTGGCCGAACGAGTCCGGGAAGAGCACATCGAGCAGCGTGCTTCCCATGACGAGG
AAGGCGATCGGCACAAGGAGGCACACGCCCATCTGCGAGATGACGGTGATCCAGCGGCCCCACTTGCCGAGCACCCACTCACCCACGTCACCGTACGTCT
TGACCGATGACGGCGCCACAAGCAGGACCTTGGACAGCGCAACCGTCGTGTACGTGTTGGCGAAGATCATGAAGGCGAGCGCGATGGACGCGTAGATGGG
ACCGGCGCGCGCATAGTTGGCAGGCATGGCGAGCGAACCGATACCGCAGACGCAGCAGAAGAGGTTGAACGAGGCCTTGGCGTCATCGGCGGTGAACCAC
GCAGACGAGCGAGGACCGGCGCCGCCG