Description :
From Genome Similarity Track
Location :
Scaffold_3256:344- 1768
Sequence
1424 bases(100 bases per row)
GTGTCCTTGTAGCTGGTTCTTATATCATGTCAATCATGTAGAGACCTGCAAGGCATTCAAGCATAAAATTTTTACCAATGGGTGGATTTGAACCACCTCC
TTTCCTTTCGGGAGCTCTACCATTGAGCTAAATCGGTGGGGGTTAGACAACAACAGCACAGGGATACTCATCTGGGTGCTCGACGGGGAATTAACGGTGA
TCCACTGTTCTTTGTGGCCGCGACATACCCTCTTAGGTGTACCGATGCGCGGTACGCCCCCCCTCAATTCACCGTTCCAGGTGGTCAATCGAGCACTGAG
CTTGCAGGGCAAAATGGCGCAGTCAATATTGCACCGGCGCCACTCGTTTACGAGGAGTAATTACGCTCAATGAACCAATTAGCGCACTTTTACGAAACCT
CCAAATTTAGGTATTAAGTACGATATATAAAGTTTTGCGATACGTCGGATCGGAGTCGGAAGGTGCTCGGCTGGTCGGAGTCGTTATGATATGGATGAAT
AACATTATCTCTCCGACGTATCTTACTTTTAGTATGTTGCGCACTAGCCAATGATAATCGTTTCTTATTCTTTATAGCCAATGAAAGCGATCTCCGTTGC
ATTGGGCGAATCAAATTGCTTCAAGAATACAATTATATCCAATTAAAACTATAGTTTAGGGTGCAGTCGGAATTCCGACGTATCTAGTCGGAGTTGACGA
CCAGATATGTGTATAGTAATACTTGCTAAAGGTTTTTGCCACGTATCACCTGCATATTTCTACCTCTCCGACCAAGAACAATGAGTCTGAACGACTTGAA
GCCCGCCAACACAAAGCGCGCGCGTGCGACGGCTTTAAAAGCGTTTGAGCGCTTCCTGTCTTTAGAGAATACTACCATGGAGCACGTCGTGGCTTTGATC
GTCGCAGACTCTAGTCGCGCGAGTAGTATACTAGTGACTCTAATGGACAAGTTTGGTGTGTACCTGGCATTCCACGCAGGAGCAAAGGGGCAGCCTCTGT
CGCGCCACTCCGTCGCTCAATACTTCCGCCAGGTGAAATGCTGGCTTTTGGATGAGTATCCTGTTCAAGGTGGCGCTGTAGCACGACAGCTGCTCAGCAT
GGGGCGTACCCTTGAACAGCCCTGCATCAAGCGTGAAAGTGGTGGGTTCGTCAAGAAGGCTATTGCGTGCACAAAAGAGGATCTCAAAAAGATGATACGC
TACTTATATTCAACGGCTCGCTGTGCGTCGGACTACCAAGATGCTGCGTTGTTGTGCCTCCTGTGGTACCTCTTCGGCCGTGCATCAGACATTACGTTCG
TCCGGAAGCAGCAGCTCTCCGTCGGAGCTGGAGGGGTTTTCTTTATCCGATTCATCCGCGTGAAGACGTCCGATGAGCAGTCACTGTCACTTTTTCGTGA
CGCTGACTTCATGACTTGTCCGCT