Description :
From Genome Similarity Track
Location :
Scaffold_1845:344- 1693
Sequence
1349 bases(100 bases per row)
TGAAGACGAGTGTTTCACATTCACCCATCCTCAGGCACTTCGATCGGTCGAAAGAAGTTCACGTCATGCTCTTTGCGAATGAATGGGCGTTGAGCACTAC
GCTAATGCAAGAACATGAAGGCAAGTTACACCCCGTACGGTTCCTCGGTCGGGTGCTTAAGGAAGCCGAGATGAACTACCATCCAGCTGAGAAGGAAGTT
TTGGCGTTACTTCTGCTGTTGAAGATCTGTTACGTCCAGCTGGCAGGAAAGACGCTACATGTCTATACACGATTCTCGACGTTAGAGTGGGTGCATAAGT
CGAAGTCTCTCTTCGGACGCGCGGTCCAGCTCGCAGTGCTGCTATCGCAGTGGCACCTTAAGGTGCAGCGCGTGAAAGAGAAGGATGTCGCCTTTGCGCA
GCTACTGCAGTCAAGCATCACGAGCTTCGTTGACCTGGAAGACTCGCTCGCGCCGGTGGCGCCTCCAAACAAGGGTTCCCCGACTGTTCGAATGGACCCC
GCGTTGCTGTACGCCAGGCTTCCCCGTAATTACAGCGGATTCGTCATGTCTTTTGACGGATCAGCGAAGACAGAGAAGTACGGTGGCTACGGGAGTTGTT
CATGGGTGCTGTGGAGCCTTCCTGAGTGGAAGGTAGTGATTGCTGCAAACGCTTACCTCTCGGCTACCACGGTGAATGAGGCAGAGTATAAAGGTATGAT
CAACGGTGTCAAGGCTGCTATTGCGCACGGTGCCGAGGATTTAGTCATCGTTGGGGACTCAAGGCTCGCGATTCAACAATCACTTGGGGTGATCGCATGC
AGGAAGGAAACTTTGCTAGCGCTGCTGAATACTCACAAGGAACTCACGGCCAAGCTTCGATCAGTTAAATATCTTCACGTTGTACGAGAATACAACGCGG
CCGCGGATTCGTTAGCCACTGAAGCGCTGGAATCGAAGGTCAGTCGGGTAATCTTGGCTGAAACTCGCAAGTCGGAATTGGCATCGCTGAACCGCATCCA
GGAAATGATCTACGAGCCGGATGAAGACTCGGTAGATGTTTCGTCACGAGGAGTAGAGCGTCAAGTACATGTACTGTCAGGCAGCAAGTCTTCAAAGTGG
AAAACTTTAGAAAATTTCGTGGTTGATTACAGCTCACCAAAGTGCGATTATGGTAATATGGCAGTGATGACTCGGCGACAGACGAAAGCCAAGAAACGCG
TCAGGTTTGCAGATGAACACTCGGAGGATGTCTCAAAAGCTTAAGAAGAGCATGAAGAACGACGAGAGACGTCCACCGAAGATTCATTCGGCGAAGATTT
GCCAGACCATCCTCACAAGACTGTACCAGCGGCATTTCCCGATGCGGAA