Description :
From Genome Similarity Track
Location :
contig_165:34393- 35596
Transcript NameFunction/comments
g13993.t1RAW37301.1 hypothetical protein PC110_g6429 [Phytophthora cactorum

Sequence
1203 bases(100 bases per row)
TGACGAGGGATGAGCTCATGAACTTCCTCGAGCGCGCGTTGCACTACCGCCCGCCCAACCTCTCGGCTACCGAGTTCCTGTCGCACCTGCGCGACATCGA
CGCTTCGTCGTCCACGCTGGCCTACGGCATCACCGACGTCGTGCGGAGTACGCTATGGCACTGGTCCACGCAGACGGCCGACCTGCTCTTCTGCTTCTTC
GTCGTGTGCATCAACGCGTCGGTGAGTCCAGCGCTGGCGATTTTCCTGGCCAAGCTCTCGGACGCTTTCGATACGCTGGACTCGGGCAGCCCGAACGAGT
CCACGCTCAAGATCGGCGTGGTGGGTGTTCTGGCACTGTGCGTGCCCTTCGTGCTGGGCGACTACGCGGTCGGCTACTTCCAGTCCAAGATGATTTCCAA
GGCCACCGAGTCGATGCAGTCAGCACTGCTGAATATTATCCTGCGTCAGGACACCCAGTTCTTCGCAGAGCGCTCGGAAGGTGACTTGAACAACCTGTTC
TCAAGTGATGTTGCACGCGTGAACGCGCTGTGGCAGGCAGTGTTCTGGAACTTGCTCAACCCGCTCGTGGCGGTGATTTTCGGCTTTGGATACGCTCTAT
ACATGGATGCCAGTATCGGTATCATGTCGTTTGGATTTACCGCGGTGCTGCTTTCAAGTGGCCCGCAGGGTTTCGCAGCACAACGTTCAAAGGAGTTTGG
CTCCAGGAACGCATACGTGGCTGCCGAGTTCCAGAATGCTGTGGGCTGCGAGAAGGTCGTGCGTGCGTACGCAATCCAGGATCCGCTCATTTCTCGATTT
AAGAAAACGTGTTCGGCGCTGCGCAAGAGTCAGTTCTCGAAGGATTTCTGGTCGAGTATTGTGCAGATTTACATCGAGTCTGCGATGTACATTTTTGTTG
CTATTATGACGGCCTCGTTGGCCATGAAGGTGTGGCACAAGGAGCTGTCCTCGGGTGAGTTCTTCGGATTCATCACACTGCTGAGTCGTGTCTCAAACCC
CGTGACGGTACTTGGTGGATTTATGCGTGTGGCCATTGGTAATGCTAGCAGTCTGCAGCGTGTTGATGATATCATTGTGGGTCTTGGGTCAAGCACCGGC
GGAGACGAAGCCGACAAGGACATGCCGCCACTCCCCAAGATGGAGCAGAACCTCCGCGTCGAGAAACTTGTGTTCAAGTACGACAAGGCTTCGGAGAACT
ACA