Description :
From Genome Similarity Track
Location :
Scaffold_122:34388- 39208
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_122-fgenesh-gene-0.3Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_122-fgenesh-gene-0.14Cullin-associated NEDD8-dissociated protein

Sequence
4820 bases(100 bases per row)
GAAGCAGATCGACTATGACGCGCTGGAGAGAGCATGGGAGGCTGGTGACGCCCGCGAAGAGCTACAATCGTCAGGTGACGAGCAGTTCGAGGCACTTTCG
TCAAAGTGAGCGAGTAGTTCTCTCTCCCTCTCTCTCGACTGGAATGTGATGGAGCGGGGCTCGCATGGCAACTAACCTCTTTCTTTCTCTCTCTCTCTGG
TTGCACAAAGGAGCGAAGAAGAAGCCAAGGCGCTGGGTCCACAGATGGTGTTCGTCACGCTTCGCGAGGATCGCGCCAACGCACTTGAGTTGCTTGGAGA
GGTGGCGTCACGCTGGAAAGAGGTGAGTAATCGTAAGTGAGCGTTCATTTGCGACGATCTGAGTGTGCTTATGCTCCTCTTCTTTGTTATGGTTGCTCGG
CCAGTCGCTTTGGAATGGCGGTCTGGAGGTGACCGTGTACGAGATCGAGCAGGACAAGAAGCTGCTCGTGGGGCTCCAGCGAGGCGTCCAAGTGGCGGAT
CTGCGCCGCTTCTTGCTGGAGCAGCCCGAAGTGCTCGAGTTTGAGTGGAACAGCCAGACGTACTCGCCTAGCAGCGATGGCGACCAGCGTCTGCACAAAC
AGCAAAAGAAAACAGCACGCTCGGGCGAGAAAAGCAAAAAGCACCGGCCGAAATCGTCGCGCAAGAAGAGAGCTGGATACCAAACCAAAAGCACGGATGA
AAACGCGAGCCAGAGAGATAAGATCAAGAAGAACACGAAAGGCAAAACGCAGCGTACCAGTACACAACAAGAGCCAAAAAGCGAGCTCTAGACAAATGTA
TGAAAGTTCGATGGCACTAACGCATCGTGAACATCTTTTTCTCTTCCTTCTTCAGTGCATTTTCCTCCCTGTGAGCGAGCAACTCAACGCGTTGTCTGGG
ACTTTGGTTCATTCATTCCACGTATATCTGGGTATGTTTCTTTAACCACTGATGCGCTCGCTCTTGATCGCATCAAGCTGCGGCGCCAGCGACTTGTTCT
TCTTGACGTTCTCGAAGAAGACGCTGAACTTTGGGTGCGAGTCCGTGTCGCGCACGCTGCTGATCGCGTCCACCGCGCGTAAGGCGCTTCGAATGAGGTC
CTTCGCGCGCTCCACCTCGGTGCCGACCTGGTCCTCCTTGACCTTCTTGTTCGCAGTCTTCTCAAGCGGCTCCACCAGCAAATCCAACGCACCAACCACC
GACCCAGGCTGCACGTGGCAGATCTTGACTAGGATCTGGTGCGAGAGCATCTGAATGTCGTCCTGATCGCGAAGTCCCTGCTGCAGGTGCGGGAAGAACG
ACACAATGTCGAGCTGCTGCGGCAGCGTCTCAATCAGCGTATCCACACACGAGTACGCAGCCTTGCGAATCGGAAGGCCGTCGTCCACCTTGTGCTTGAA
CGGACCGAGATCGACCGTGCGCTCGAGCTTGATCTCCGTCGCGGCGAGAAGCGCTGGGAAGATCGGGTCCCGAACGTACGGGATCAAGAAGTGCGCATGG
TGGTGCGCGCCAGTGTTGAGCGCCAACAGCGCCGCACGACGCACGTTCAAGTCTTCATCCTGAAGCGCCTTCAAGAACGGCACAATGTGGGAAAACAGCT
TCTCAACAGCAGCGGTGTTTGCTGACGCCGTGAGCGCGTACTTGAGGCTCGTAACACCAGTCCAGCGAGAGCCGACCGAGGCGGAGCCACACAGTTCAGT
CACGACAGGGATCAGCTTGTCGCCGTTTGTGATGGAGAGCTTGCCCAGGCACTCCGCAACCATATTGCGCACGCCTTCTTCCTCTCGCTCGCTCATCTTT
TTCAGCACAGGAAGCACGCGGTCGACGTACACGGTGAATCCGTGCTGTGGACTCGCCGCGTGGTCAGAGATGACTTCACGCAGCGAGCTCAACAAGAGGT
ATGAGTTGCCTCCCTGTTCGAGCTTGTGCATGATCGTCTCCAGGTACTCCTCCGTGTTGCCCACGCAGATACTGCCTAGCGCGTACGCTGCAGCCGCCTT
CACTTCCTCGCCATTCGCAGAGAAGTTCTCCAGAATGGTCTCCTTCACATCGGCGTATCCCTTTAGGTTGATCTGTCGTCCGAACTCTCCAAGGCTGTAC
AATGCCACGACCTTGTTCTCCTCCGAGTTCTGACTGGTAATGTCGCCAACGAACTTCGAGAACGCGACCTGGCGGTTCGCCTCCGAGGTCACCACGCAGG
TAGCAGCGATGCAGCGCGCCAAGTTGAGCACCGAGTGCTTCGAAAGGTCGGATGGAGAGTCCATGAACGCGTTGAACAGATCCGTGAAGCTGCTGCCAGA
CAAGTTCAGCTCCGTAAGCTGAGCAAAGAATGCCTTCAGCGCCTCCAAAGTCGGACCTTGAAGCATCGAACTGCGGCAGAGCGAAATTGAGTTCGCAAGT
GCCTTCTGCAGCAAAGCATCGGTGGATGCAATCGTCGGCGAGACACGAAGCGTGTTCGAAATCAACACGATTCCCGTGCGGCACAGCTGGAGATCGCTGT
CTACCACGAGGTACGAGGCTTCCGAGACCACGTCCGAGAGGAGTTCCTGCTTGATTTGAGTTCCTTTGTGAAGCACGAGGTTGTTCAGCGCATCCAGCGC
GGCTTGCTTCAAAGTTCGCGACTGCTGGCGAAGAAGCTGGGAGAGCGCGATGATGCAGTCCGACAGGATCGAAGACATATCGAGATCCAGCTTGGAGCGC
GCAATCACAGCGATCGCTTTCATGCTCTGCACACGAGTGATCTCGTTGTTGAGACGTTCCATCAGCAACGGGTAGACCTCACCGACACGGGAGCTCAATT
CGTCACCTATTCATACACACATAATTAAGCAACTCAGATTGTTCAGGAGATAGGCAGAAGCATAGCAAGACGTAGACACGTACCAAGTTCCGCAACAATT
TGCCCAATGCTGCTAATCGCAGACTCTTTGATCTCCTGGTCGATATCATGCGCCTTCAAGCTTGGAAGCACGGCTTCGAACACTGGCACCGCGTGGCTCT
TGGAAGCAGAGTCGTTGATCTCCGAAATCACGCGAACCAACGATTCAATCAAACCCAGAGCCTTCGCCACAGTCTTGTACCAGTCACCCTTTGCACAGTG
CACCGCAGCGTGGACAATTGCACCAATGTGCTGACGGAAAGGCTCCGCTGGGTGGGTGTCGATGAGCAGTCGGAGGAACACAAGCGCATCCAGCTTCAAG
TCCGAGTGCTTGTCTTCCGCAGCACGGAGGATGTTCGGCAATAACACGTTGATGTAGTCGCTAAGCTGGCCACGTTCTACAGTTGCCAACTCGCTCAAGA
CCGCAATCACAGCACAGCGAGACGAGACCGACGCTTTCGGTCCGAATTGCTTGTTTGCAGAGAGAATAATCACCTTGAGACGCGAGTGAACTTGCTCGAG
GCACTTGCTCGACGAAGGTGTAGCAGAACCACCGTTTGGAAGAGTACGGCGAGTTGCGCGGAGCAGCTCCGCAAAGACAGAGAAGACGTCAATGCGGACG
TTTTCTTCACGTTCCTTGAATCGCGAAATGATCTGCTGGCTGTAGTTTTCATACAGATGCTCCAGCAGCTCCGGACGGGTCGTGATGATAGCCGTGAGCA
CGCGAAGACCGGCACGACGCACTTTCCAGCTGGTATCGTCGTCGTCACTGTAGTCACCATCGTCTTCATCCGAGTACTCTTCTTCGTCTTCATCCATTGT
CTCATCTTCGTCTTCCGAGTCGCCGTAGTTGTAGTTTGGATCGTACTTGATGAACTCCATCACCAGCGTCAGAATGCTTTGCACGTGGGGAGTGATCTCG
TTGTGGCACCGAATGACAAACGACTCGAACGCCTGGAAGCAGTTCTCCCGGAGCTCACTGGATGCCTCGTTTTGCAGAGATTCGTCGTCAGGTTCACCGC
AAAACTTCAGCAGAATCGGGATAATTGCGCTCAAGTGTTGCCCTAAGCGGTGGCCCGCAGTGCGCGAGAGCGTGCCGATGGTCTGGATAAATGTGCGCAC
ATCCACCGAACCGCTTGACGCTTCAATACCCTTGATCAGATGTTCCACAAGGCGAGTCAGCAACGCATCCGACGCCATCACACCAAGAGAGCCAACACAC
GCAGTTGCGCGCTTGCGCACGAGTGGCGACACATCGTTCAGTTGCGTAATCAAGATGTTCATGATCGTGTCGTGCTCCGTCGCAATATCATGACCAAAGC
GACGCAACAGGTCCGTCAAGATGTCAAGCGTCTCCGACTTCACTGCCTGGTCCTTGTCCTGCCCAAGACCTTTCAGCAGACGAGCGCACAGTCCTGACGC
AATAGCAGCGCCAGTCTTCGTCGACACGTCCGTGAGGATTGTTTTCAACCCAATCGAGTAGATATCACGCAATTCGGGCTTGCCGTTCAAGATGAGATCG
CTCAGCTTCGCGCAGATATCGGCCACCTGAGCTTCTTGCACTTTCGTCACCAAAATGCCCAAACTGGATTGTAAACACAACACGGAGTATCAACATCGAT
CAGCTCTTGTTCTCACGGCGGACAGCACCACATTATAGTTGCCCACAAAGTTGCGTACCATTTCACGGCGATCGACTGCACATCGTTCGACTTGTCGTCA
AGCTGCTTCAGCACCGCAGCGCACACCCTGCGATAGTCAACACATCACATTTCATACACCATACACTTAGAACGTCACTCCATCAAACTCCACCAGAGAG
AAAGTGCATGGCACATACTTTGGCTCAAAGTACGGACCCAGCTCCATGTCCTTGTTGAGCTCGTTACAGAGATCCGAGGTCGCCATGTAGCGCTCATCTT
TGTCAAAGTCCGTAGTCTAA