Description :
From Genome Similarity Track
Location :
contig_165:34383- 35586
Transcript NameFunction/comments
g14518.t1RAW37301.1 hypothetical protein PC110_g6429 [Phytophthora cactorum

Sequence
1203 bases(100 bases per row)
GACATGACGAGGGATGAGCTCATGAACTTCCTCGAGCGCGCGTTGCACTACCGCCCGCCCAACCTCTCGGCTACCGAGTTCCTGTCGCACCTGCGCGACA
TCGACGCTTCGTCGTCCACGCTGGCCTACGGCATCACCGACGTCGTGCGGAGTACGCTATGGCACTGGTCCACGCAGACGGCCGACCTGCTCTTCTGCTT
CTTCGTCGTGTGCATCAACGCGTCGGTGAGTCCAGCGCTGGCGATTTTCCTGGCCAAGCTCTCGGACGCTTTCGATACGCTGGACTCGGGCAGCCCGAAC
GAGTCCACGCTCAAGATCGGCGTGGTGGGTGTTCTGGCACTGTGCGTGCCCTTCGTGCTGGGCGACTACGCGGTCGGCTACTTCCAGTCCAAGATGATTT
CCAAGGCCACCGAGTCGATGCAGTCAGCACTGCTGAATATTATCCTGCGTCAGGACACCCAGTTCTTCGCAGAGCGCTCGGAAGGTGACTTGAACAACCT
GTTCTCAAGTGATGTTGCACGCGTGAACGCGCTGTGGCAGGCAGTGTTCTGGAACTTGCTCAACCCGCTCGTGGCGGTGATTTTCGGCTTTGGATACGCT
CTATACATGGATGCCAGTATCGGTATCATGTCGTTTGGATTTACCGCGGTGCTGCTTTCAAGTGGCCCGCAGGGTTTCGCAGCACAACGTTCAAAGGAGT
TTGGCTCCAGGAACGCATACGTGGCTGCCGAGTTCCAGAATGCTGTGGGCTGCGAGAAGGTCGTGCGTGCGTACGCAATCCAGGATCCGCTCATTTCTCG
ATTTAAGAAAACGTGTTCGGCGCTGCGCAAGAGTCAGTTCTCGAAGGATTTCTGGTCGAGTATTGTGCAGATTTACATCGAGTCTGCGATGTACATTTTT
GTTGCTATTATGACGGCCTCGTTGGCCATGAAGGTGTGGCACAAGGAGCTGTCCTCGGGTGAGTTCTTCGGATTCATCACACTGCTGAGTCGTGTCTCAA
ACCCCGTGACGGTACTTGGTGGATTTATGCGTGTGGCCATTGGTAATGCTAGCAGTCTGCAGCGTGTTGATGATATCATTGTGGGTCTTGGGTCAAGCAC
CGGCGGAGACGAAGCCGACAAGGACATGCCGCCACTCCCCAAGATGGAGCAGAACCTCCGCGTCGAGAAACTTGTGTTCAAGTACGACAAGGCTTCGGAG
AAC