Description :
From Genome Similarity Track
Location :
Scaffold_267:3438- 7728
Sequence
4290 bases(100 bases per row)
GTCTTCGTCCGCCACTTGCGCCATCTGAAGTCGATTCGCGCTCTTCTTGGCTCGTAAATAGTCGTACAGCAGACCTCCACATGACAAGTTGGATGCTGGT
TCCCAAGTTGGGTCTTCGTAGCCCACCTACTTGACTTTGAACTCGCGTACAGCACGCTCCGTGCTTGTCAACAGTGGTGTTCTGTCATCGAGGATGGCCT
CGACTTCATATTCACCGGCAACTTTATCTGGTTCCCAGCTGTCTTCAGGCAACAGTTCCTCTTCGAAATCGAGTCTTGCTTCATTTGTTGCGTCTAGTAC
CAACCGAGTGTTCGGTCGACTGCTGAATTCGTTGACAGCCTTGAGTCTCGACACATGCACTACTGGGTAGAAGCGATACCCACTTCGGTATGGCAGTTCC
AGCTCGTACGCAAACTCTTCCACCTTGCGCTTGATCCGAAAAGGTTCATTGCACCGATGAGCTAATGTTTTCGTCAAGCCCGGTTTGACGCGTTCCATGT
ACAACCACGCCCGGCTCCCAATCTCAAAAAGAGATCTCGGTGGGGCTCTTGCAGGATCCTCTGTCTCTTCCGAAGCTTCTGGAGGGCCCACCGAGTATTC
ATTTCCACTTGGTTGAGGTACAGCGGCTTTTTCCAGTTGACTCAGGGCATCATTATGCTTTTTAGCCCTTCGCTCCTTTTCTACAGCCTAATAATCTTTG
GCCATAGTGAGGGCGATCTCATGTTGTCGATTGATCTCACGCCGCCACGCCAGTGCGTCAGACTGCTTGCCGAGTCCTCGTTTGAGTGATGACGACATCG
CCCGCAGCGTCGACTGCGCATCCCAACCGTGAGCGAGGTAGAGCGGTGTTTCTTTCCTCGTAGTGTCCTGAGAGGTATTAATAGCGAACACCAGCTTTTC
GGCGATTTCGTCCCAGTTTTGTTGTAGAGGATCCTCCGTGTACACTCGTACGGAGCCCATCACCGACTTCACCGAGCGTTCTTGCTGTCCATTAGCCTGT
GGACGATAGCTCAAAGTTGCTCGTGATCTTGACTGCATCATCTCTGCGAACGCATGGAAAACCTCGCTCATGAAGCGTGGGTCACGGTCGTGTCTTAAGA
ATGATGGGCTCCGAACCGTCGGTACACACATTCTTCGAACACTTGAGCAACACTCAGTGCTGTTGTATCCGACATTGCCTTGGCAATGACGAATCCTCTG
AACGTGCACTGAAATAGGAGCAACGCCGTGTTGCCCCTGCGAGATTTCCGTAGTGGGATCACAAAATCCATCGAGACGATCTGGAAAGGTCGTTCGGCTA
GTACGTTGCCAGGCGAGTATCCACGACGCTGCGGACGGCTTTTACTCGAGCTGCAATCTGGACATGACTTCACGTGCTTCTGCACGTCAGCGTACAAGCC
GATCCAATAATAATCGGACTTAACGCGATGGAACGCTCTCACCACACCTTGATGTCCACCTTCCAGCGAATCGTGACAGTTTCGTAGGGCCTCTTGAATC
ATCGTTGTCGGTACTATAAGCCGCAGCTTGGTCTATTCTTGCCAACCATGGTCGTACCGACGATTCAGTCCAAGATAGTGAAGCGCGCCGTCTTCTGATA
ACACGAATCGGTCAGCGTACTTGTATGCATCTCGAGCTTCTTTATAACTCAGCTCTTCTGCTTGGGACTGAAGCACCTTCTTGATGTCAGACCACTTCTT
CTCCTCGTCTTGTGCCACCATTATCCGTTTGCGTCGTTCACGCTGAATTGCTACCGGGTCAACATCTTCCGCATCGGGAAATGCCGCTGGTACAGTCTTG
TGAGGATGGTCTGGTAAAGCTTTGCCTATTGAATCTTCGATGGACGTCTCTCGTCGTTCTTCATGCTGTTCTTGAACTTGTGAGACCCCCTCCGAGTGTT
CATCGGCAATCCTGACGCGTTTCTTGACTTTCGTCTGTCGCCTAGTCATCACTGCAATATTACCATAATCGCACTCTGGTGAGCTGTAATCAACCACGAG
ATTTTCGAAAGTTTTCCACTTTGAAGACTCGCTGCCTGACAGTACATGTACTTGACGCTCTGCTTCACGTGACGAAACATCTACCGAGTCTTCATCCGGC
TCGTAGAGCATTTCCTGGTTGCGATTCAGCGACGCCAATTCAGACTTGCGAGTTTCCGCCAAGATGACACGACTGACCTTCGATTTCAGCGCTTCAGTGG
CTAATGAATCCGCGGCAGCGTTGTATTCTCGTACAACGTGAATCTATTTAACTTATCGAAGCTTGGCTGCGAGTTCCTTGTGAGTATTCAGCTGCGCTAG
CAAAGTTTCCTTCCTGCATGCGATCACCCCTAGTGATTGTTGAATCGCGAGCCTTGAGTCACCAACGATGACTAAATCCTCGGCACCGTGCGCAATAGCA
GCCTTCACATCGTTTATCATCACTGCGTACTCTTCCTCATTCACCGTGGTGGCCGAGAGGTAAGCGTTTGCAGCAATCACTATCTTTCACTCAGGAAGGC
TCCACGACACCCATGAACAACTCCCGTAGCCACCGTACTTCTCTGTCTTCGCTGATCCGTCAAAAGACATGACGAATACACTGTAATTTCGGGGAAGTCT
GGCGTAACGCAACGCGGGGTCCATTCGAATAGTCGGGGATCCCTTGTTTGGAGGTGCCACCGGCGCGAGTGAGTCTTCCAGGTCGACGAAAGCTCGCGAT
GCTTGACTCCAGTAGCTGTGCGAAGGTGACATATTTCTCCTTCACGCACTGCACCTTCAAGTGCCACTACGAGAGCAGCACTGCAAACTGAACCGCGCGT
CCGAAGAGAGACTTCGACTTGTGAACCCACTCTAACGTCGAGAATCGTGTATAGACATGTAGCGTCTTTCCTGCCAGCTGGACGTAACAGATCTTCAACA
GCAAACGTAGCGCCAAAACTTCCTTCTCGGCAGGATGGTAGTTCATCTCGGCCTCCTTGAGCACACTACCGAGGAACCGTACGGGGTGTAACTTGCCTTC
ATGTTCTTGCATAAGCGTCGTGCTCAACGCCCATTCATTCGCAAAGCGCATGACATGAACTTCCTTTGACCGATCGAAGTGCCTGAGGATGGGTGAATGT
GAAACACTCGTCTTCAGTTTCTCGAAGGAACGACGTGCCACAGAAAGGCCCCTTCAGCGACAAAATCTTCATCTTTAAGATGGTACAGCGCCGCACCGTA
GACAGCAAAGTTTTGAATAAAGCGGCTGTAGTAATTAACCTCTCCAAGCAACGACTGCATGCCCCGCTTGCTCGTTGAAAACGAAAGCTGGGTGATGGCC
GCAAGCTTCTTCGGATCAGCCCTGATACCTTCTGGCGAAAATTTATGCGACAGAAAGGCCACCTTGGGCTGGCAGAAGATGCTCTTGGTGAAATTAATGC
TGATCCGACACTGTGCAAATCTTGCCAGCAATCGGTCCAGCGTGGCCAGGCAGCTGTCGAAATCCTCGCCACCGAAGCAAATATCATCCACAAACGATCG
TCGACCAAACACGGGTACCAGCGATGATTCGTCTGGTTCCCCGTTCGTAAACATGTCAGCGACGGGGCTGTTGACGAGTAGTAGTACAGGATCGGCCTCC
ACCGGAGCTTCGCGGTCTGCCGCGAACTTCGCTTGAAACGAACCCTCAGTGATTGGCCCACGACGTTCCTTGTCTTGTTCTTCAGCGAAACGCATCTTCT
CCGAGTATTCAAACCAACCTCCGTTAAATTGAACGAACCCCCAGAGTGCGTTGTCAATCATACATTGGTTGGTAGATCATCGGCGCGCTTTTTAACCCGA
AGGGCATGCGTAACCACTCGAAATGTCCGAGTGCACAGACAAACGCCGACACTTTACGTGCTCGCAAGGTCATCATGACCGCCCAGAAATCGCTTACAGC
ATCCAGCGAGCAGAACCACAGGTAGCACTCGAGATCGGTCAACAGATCGTCGACTAGCGGCATTGCATACTCCATGATTGCGGTGATGGCGCTCACCATC
TTGTAATCGATGCAGAGCCGGATGTCCAGCCCGTTCTTTTTCATCACAATCACGATCGGCGATGCCCATGGACTGTCAGAAAAGACGATCAGTCCTGCTC
GCAACAAAGCGCGTAGCAGCTCGTACCGATTGCCGAGAAATCGTAACGGCACGCGTCGGGCACGCTGTTTCATTGGGGCGTGCCCTTGCGTGTCGATATC
GCAGACTGCGCCGTAGGCGGGCGGCGGCAGTGCGTTACCACTAGCAATCAGGATGTGCTCGTGGTTCTTCAGCGTCGCGACCAGACGTTC