Description :
From Genome Similarity Track
Location :
contig_46:34379- 35415
Transcript NameFunction/comments
g9566.t1hypothetical protein

Sequence
1036 bases(100 bases per row)
TTCGACCTGTCGAGCTACACGGGCGGAGCGCCGCTGATCCCCATGGGAGACGCTGGTGCCGGTGTTGGAGGAGCCTCCACCACGGACGCGCACGGGATGT
TTGACCACCAGGAGCTCCTGGGAAAGAGCTCGGACGGCGAGGAGAAGAAAATGGGGAGGCCCAGCCACCCGGCCTGGCAGTTCTTCGTCGAGGAGAGAAG
CGCAACCGCTACCACCACAACGCATACTGCAGGTTCTGCAGCGAAAATGGAGTCGACCCCGTTGCTGTGAGAGGCGTGTCGGGGAACATGATCCGACACC
TGCAAAAGTGCATTTACTGCCCTGCGGAGGTGGTGACGCAGCTGAAGTTGCTCTGCGCGCAGAAGGATGCTGCGAGCTTTAACAAGAGACACCAGTCGAA
TCGCAGCGTCGACGTGTATTTGCAGGACACGTCGCCCGCTCCGAAGAAGAGGACGCGGCGAAGTGTAGGGGCAGGAGACGGAGCTGCTGTACCGTTGCGA
AATGTAGCCTTGCGCGGATCCGTAGCGTTGGATGGTAAGGCGAGTGCTGCTACACAGGATACAACTGGAGTGGAAGACTTTATGCCACTCCAATTGCCTT
TGTTGTCCACGGACATGAATGGAGCGCTCACGACGAGTATATCTTCCAAACCGCTGAGCTATGAAGAAGCTGCTTCCACGCCGAAGAAGCCAAGCGCGTC
TGCGAAACCTCGATTCCGAGATGTCGGGAAGAAGCACGGGAATAATCGAGCTGTTCAGCAGCAGTCGAATGAACTTCCGATGACTCATGTGGCAAATAAC
GTGGCCAGCTCAGGCACTTTGAATAAGCTGATTGTATCATCAACTGTGTCAGCGGGGCTGCCTTGGGATTGGGTGTGGACGGAGCAGTCTGCTCGAATGT
TTGGTGATCTCCATCAGAAGGTCGACCCGCCAACTGCTGAGTTGTTGGCATCGATGGGAACCACTTCGTATGAAAAGCAGATTCTGAAAATGAAAGACGA
GTCAGTTGGAGTTACGCTAGCAGTGAGCTGGTGGGT