Description :
From Genome Similarity Track
Location :
Scaffold_56:34370- 35784
Transcript NameFunction/comments
g17880.t1XP_009531379.1 hypothetical protein PHYSODRAFT_562384 [Phytophthora sojae

Sequence
1414 bases(100 bases per row)
CACGAGCTGCGGGTTACCCTCACTGAAGCGCTTCTTGCCGTTCTCGATGGCCGCGTCAACGTTCTCCACCAGCTTCTTGTAGTCCAGACGTGCCTTCACA
TGGCCGTGCAGGGTTGAGGAGAAGTCGACGTCGTCGGGGATCAGCGCGGCGGTAGTGGCGATAGATCCAGAGGCGGACGAGGAGAAGAAGGACGTGTGAG
TGAGCTGCGAAGTGGATGCGATGCAGCGAGGTGCTCGAGAGAAACACACGCGCGCGAGCGCCACTGCGTTGCGGGTCGGCAGCACAGGCATCTTTGATTG
AGATGTGCGGCTCGAAACGCTGTGTGTGGAACACACAATTGTGGGTCTTTCGGTGCATGTAGTATTCCATAGAGTAGTAGCAATCATAATGATGTTATCA
TTATTACTACTACTATAACAGCCGAGTCTGGGCCACTATTATAGTAGTGCTTGTTGAGTAGTAGCAAAAAATGGCGCTAATAATAGTAGTTTGAAACTTC
AACCTGCCCAAAGAGCACGCGAATGAGTGATTCTCTACTGGCACGATGCGCAGGCTGGTGTCGGCGCGAGGAATAGCCTTATAAGCAGGAAGACGACACA
AAAGAACGCTGTGTTTCGCACTGAGCAACTTTGGGTTTGAGGAGGGAAACCTCGAAGGTGCCAACCCTCCTCCGTTAGACTAAACAGTATACATTCAAGT
ATACACTAACGGTTACATACCGAACTGCGCGGTATAGTCCCAGACGTATACACCAACGACAGGAAACACGACCTTCGTCACATCTATTCTCTTCCTCCTG
CTCGCGTCGAATTGCAGAATAATACAAGCAGAAATGCGTAAGAATTGTAAGCATGCAACGAGAGAGAGAATACAAAAGACGCCAGCAGATTGGCTAAACG
TGGTTGCGAACTCGTCAGAAAATAGGATGCTCAGCAATGTGTACCATCAATGCTGTGTCCGAGCGTCCAATACGTTCGCTGTTTCGGACCCCCCCCCCCA
TGTACAAGCTTGGCTACATCGTGGTGGCGCAGAACAGCGATACGTTCATCTTTCTTGGCCCTGTCCCTGACGTTTAATCATCGGTGTGTGTATCCCTTCT
GAATGGCATCAGCTGTCCATGCAGCGTAGTCGTCGAGTGGCTTTGGCTGTGAAACAGCGTCGGTAAGTGTAGCAGAGTCACTGGATGAATCCGGTGTTGT
GTCGATATCGACCGAGCTGTCTGAATTCAGCAGACTCTGCGTCAATCCTGCTTGACTTTGAGGCACTAATACGATTGTGGACTGCAGCGGCACCGATGCT
GCGCTCGGCGGGAACCATATCTGTCGGATGTCAGGCGCAGCATGCTGCTGAAGCACTCCAGGAAGATGAGCGTTTGAAGAAGGGGAGAGAAAATACGGTG
TCGTATCGTTGATA