Description :
From Genome Similarity Track
Location :
Scaffold_46:343680- 345341
Sequence
1661 bases(100 bases per row)
GATTTTAAAGGTTAGTGGCACCAATTTCTCCCCAAGGCCCTTAAAAACGCACTCGATCAGCTTTATTTGCTATCAAACCTGCCTTGTATACGATCCTGGC
AAGCACTCCTCATAAGTTTTAGATTGGGTTGAATTCCGGGGAATTCTGTGGCCAGTCAAGACCAGGAAAAGTTTGGTCTGCATACCATGCCTTCGTATAC
CGAGATGTGTGTTCGACGCGTTATCCTGCTAAAATCTTAGTCCATAACCACCCAGCTCATGGACAGAAGGCACGAGATAGTTTTTAGTATGCCTACGTAC
TTTCGCGCTTTTGCTTCCTCTCCAAGACAGCTAATATGCTTGTCTTAGTGCCTCCAAATGCACCCCTACCATAACTGACCAAAATCGGATTGACGAGCGA
AAAGCTGGTTGTCGTTCCTTATGTTGTGGATATAGCTTTGGAATCCATCTGGTTCATCCAGATTGCACTTGTTTCGTCCGAAAAAATGATTTCGGCCCAG
GTCGTCATCAGAGAAACGGCTTCTCATAGCACACTGTTTAATACGAGCTGCTTTGTGCCTTTCGGTAAGCACTGGTGCATGTTTACGGTTGAGAAACTTG
AGCGTGAAGCTTTCGTATAAAGCTGATAGACTCTAGAAATACTTACAGGGAGTTCCATTTACGCTTGGAGCTCCCGTATAGATATTGCAACCCCATGAGT
GGCACGAAGTAGTCGGCGGAGATCCATTTCAGTCAAAATGGTTGATCTTTCGGATGGTTTGTACAAACTATAGGTGGCGGTTTGTTTAAGAACTATTTAA
CGACACTTTGGGATTGAACGATGCGCCGGGAAACTTTTTGATGACTCATTTTTGTCACGTGGTAGGCAATACTTTACCCATCCCTTCTTCAGTCAATCTC
AGGCCGCTCGGTACTATTCTGCAGAAAATAAGATCATATATGGTAGCTTCACTAAGAGGGATTGCAGCAAAACCAAATGGACCGAAAAGAACGCCGTGAT
GGTTACGTAAAACGCGGCGTTATTTAGTGACTCTATCATCTTTGTCCTACCCCCGCCCCCGCTCTTTTTGTTTTACGCCGTGATGGTTACGTAAAACGCG
GCGTTATTTAGTGGCTCTATCATCTTTGTCCTACCCCCCCCCCGCTCTTTTTGGAGTTCGTCAGGCTGGAGGCCTAAAATCTGATAGGGTGATGTTACAA
ACTGATCCTCTAGTCTAGCGCTACTACGAAATATAATATTATCATTATGTTCATTTCTTTTTGTTGGTAAGCTGAACTGTTGGGGGCTCTATTATTCCTG
TCCGTTCAATATTCAGATATTGGTCAAGTTGCTGTTGTTCTTGCTCGATAAATTTGCTACAAAATCAAACCTATCCAATCCCGTAGTCTTATCTGAACGT
CTGCTGATTGATGATTACATCTATGACATTTCTTGGCGCGTCCATGTAAACCGCAGAACTTTGTTGCCGACGCAAGCACTGGACAAGATGCTCGTCCTAT
TTAATGGATTGTCGAAGCGGAGGTTAAGGATGGAATTCTTGTTGCAGTCCAGACAAGTCGACCTACAACGCGAGGTCCTCAGAGTAGAGCGGTTTTGGTT
CGAATTTGGGAGTGGGAGCAGGTATTAACCTCCTAGTGATGGAACTTCCCGCTTCTTCCAA