Description :
From Genome Similarity Track
Location :
Scaffold_261:34364- 35742
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_261-snap-gene-0.23DUF895 domain-containing protein

Sequence
1378 bases(100 bases per row)
GCAAACGCGCAGCAGCGCAGTGCGCACAGGACGCTCGCGGCGCAGAGCGCCACGTTGATCTGCAGCTGGGTGAGTGGGTCCATCTGGATCGCGCCAAGGT
ACCACGCGAGCGCGGCGCTCGCAGCCTGCACGCTCTTGTAGACGCCCGCGTAGCAGCCCGAGGCGATGACGTCTTTCGCGGTAACGAGGCTCATGAACCA
GTAGATCCACACCTGGCAGAGCGCGTCGTGGACCCCGTAGACGATGTACAGCAGCAGCGCGGGGAGCAGCGATGACGCCTGCGTCGTCAGCACGTCCATG
TTGAGACTCTGCTGGTAGGTCAGACGTAGCCACTTGTCCTGCACGTACCAGCCGATCATCCACATGACAGTCGCCAGCACAAGAAACCCGAGTAGAAACT
GCCTGGCGATCCCCCACGGAGCTTGAGAGCGCCGAGCGTACCTTGTTGACTGCGTAAGCGAGCGCGCAGTCGTCGCCATCTGACTGTCGAGAAAGCTACC
GGACGCGAGCGCGCCGCCCATCTGCGCGAGCCAGTAGCAGGCGCTTGTGAGTCCGCTAGTGCGCATGTTGAACCCTGCGGTGTTGTAGAACGAGTGGTAC
GCGTAGAACCAGTTGCTGTACGCAAACAGCGGCAGCAGCGCGAGTAGGATCTTCCTGTGGCGTTCGCTGCTCACCACTCGTCGTGCATTGTACACGCTGC
TTTGCCACGATCTCCACGCTGACGACTCGCCACTTGAGTGAGGTTTTACGTACACTGGCTCGCCGTTGTCCTTGACCACATTGTCGGAATCATCGATCAC
CCACCACGCGAGCGCCACGCCGCCGCCCATGAGCAGCAGAAACACTACGTACATCCCATTCGACGCGCGCGATAGCGAACTCTCAGGATTGTCGACAGCG
GCGCTGCTCAGGCTCTGGTTGAAGTTGAGAGCAAAGCTGATCACGCCGCCGGCAGTCGCACCCATGTTGAAGATCACCCAGAAGCGGCTCACGTTCTCGC
CCTGACTCTCGACGCTCGGGTAGCTCAGCAACATAAGACCCTGTGCTGTCCAGAGAAAGCCCGCCGCCACCCCCAACACAACGCACGCAGCGTAGTACAC
TGGCAACGGTGCGAGCCAGTCGTTGTGCACATTCCAGAGCGACACCGTGTACAAGAAGTAGCCCAGAGAGCCGATCGTGAGCGTACGTCGAACGCCGATT
GCGGGGACGAGCGCCGCGGCGACCAGGCTGCAGACCGCGAAGCTCAGGTACACGAGCGCGTTTCCGGCAAACGCGACGCGCGGGTCCGCCAGTCCACTTG
CGAAGGACGTGAGCGCGTTGAAGAGCCCCGGCCCACAGAAGCAGATCCACGCGAGCGCGCGCAACTGGGTGGATGCAG