Description :
From Genome Similarity Track
Location :
contig_46:34362- 35398
Transcript NameFunction/comments
g8163.t1hypothetical protein PHYSODRAFT_293408

Sequence
1036 bases(100 bases per row)
AGCGCCGCTGATCCCCATGGGAGACGCTGGTGCCGGTGTTGGAGGAGCCTCCACCACGGACGCGCACGGGATGTTTGACCACCAGGAGCTCCTGGGAAAG
AGCTCGGACGGCGAGGAGAAGAAAATGGGGAGGCCCAGCCACCCGGCCTGGCAGTTCTTCGTCGAGGAGAGAAGCGCAACCGCTACCACCACAACGCATA
CTGCAGGTTCTGCAGCGAAAATGGAGTGGACCCCGTTGCTGTGAGAGGCGTGTCGGGGAACATGATCCGACACCTGCAAAAGTGCATTTACTGCCCTGCG
GAGGTGGTGACGCAGCTGAAGTTGCTCTGCGCGCAGAAGGATGCTGCGAGCTTTAACAAGAGACATCAGTCGAATCGCAGCGTCGACGTGTATTTGCAGG
ACACGTCGCCCGCTCCGAAGAAGAGGACGCGGCGAAGTGTAGGGGCAGGAGACGGAGCTGCTGTACCGTTGCGAAATGTAGCCTTGCGCGGATCCGTAGC
GTTGGATGGTAAGGCGAGTGCTGCTACACAGGATACAACTGGAGTGGAAGACTTTATGCCACTCCAATTGCCTTTGTTGTCCACGGACATGAATGGAGCG
CTCACGACGAGTATATCTTCCAAACCGCTGAGCTATGAAGAAGCTGCTTCCACACCGAAGAAGCCAAGCGCGTCTGCGAAACCTCGATTCCGAGATGTCG
GGAAGAAGCACGGGAATAATCGAGCTGTTCAGCAGCAGCCGAATGAACTTCCGATGACTCATGTGGCAAATAACGTGGCCAGCTCAGGCACTTTGAATAA
GCTGATTGTATCATCAATTGTGTCAGCGGGGCTGCCTTGGGATTGGGTGTGGACGGAGCAGTCTGCTCGAATGTTTGGTGATCTCCATCAGAAGGTCGAC
CCGCCAACTGCTGAGTTGTTGGCATCGATGGGAACCACTTCGTATGAAAAGCAGATTCTGAAAATGAAAGACGAGTCAGTTGGAGTTACGCTAGCAGTGA
GCTGGTGGGTGGCCAAGTATCCACGATCGAACTTTG