Description :
From Genome Similarity Track
Location :
contig_47:343519- 347422
Transcript NameFunction/comments
g9706.t1ETO85362.1 hypothetical protein F444_00883 [Phytophthora parasitica P1976
g9707.t1XP_009523414.1 hypothetical protein PHYSODRAFT_313245 [Phytophthora sojae

Sequence
3903 bases(100 bases per row)
ACACCACCGGGCGGCGGGCCCCACGCAGCGCCAGGGGGAGGAGGCGGCGCCTGGCGACGGACTTGCGGGTTTTGAACGCGTGCGTGGCGACCACGCATGA
TGGCCTGGATCTTGGTAGCTGCCTGCGCATCTGTCAACGGTAGAGCCTCCGGGAAGGCCGTGCCGATCTTCGTGTCCTTGCCCCGGCCGAAGCTGAAGCA
CTTGATGTTGCACAGGTACGGGCCGAGCTGTACGTTGTTGTTCTCCTGGCCGTTCAGGTAACACATGGTGTACAGGGCCATCTCGAACTCCGGGCTCACT
CCGATCAAGCTGCAAAATGCCACCACATAGTCGTTGTTAGTCACGTTGAATGTAGAAACCTTGATTGCAGTAGCCAAGTTTCACCTCGTGGACACGGGCT
TTATCTCGTCTTCCCACTGGAACTGGAACGTGATCAATTGCTCCTTGTTGTGGGGCTCCATAAACTTGCATCCGCGCTGCTTAGGGCGAATGTATCCCCT
GTAGTCGATGCGGCCGTTGCGCTCCTCGTTGTACACCTGGAGCCAATTGTGGCAACCGCACACTTTGCCCTGCTCGGCGAACAAATCCATTAGCAACAAG
ACTAAATCCACTGATCAGATAAATCATCAATCTCACATTCTTCTCCTCGCCAACGAACACGTGCTCAAAGCCCGACGAGTCGTTGCGCACTTCACGGCGG
TACAGCCCGAACCAAATGAGCTCGAGCTTTTTCTTGAAGTCCCCCATGTCGCCCGTGAACTTCTTGTTCTTGACCAGCCAACTGCAATTGACCGCATACA
GTCAGAACTACATCTACACCCTCACCGCCATCACCGCCATACTCACGCGTGGGCATAGCGCATGGGCGCCGTCTCAAGCACAGCGTTCAGGAACGCGTTG
TTCTCCGCCAACTCCTTGGGCGTCACGCGCTCCGTCACACCTGTCTGTGTATCACAAGGAGCCAATTACCACATAACTCCAGTCACGACTCCACTCTGTT
CATTGCACTCTCCAAACTGGTCGCACCTCGCGCTCGTAGTTGTCCAGCAGGTCGAAGAGCAGCTTGTACGTGCGGCGCTCGAAAACGCTCGGGTCCACGA
ACGTGAAGAGCGGCTCGCGCGCCGCGTCACCGCGGGCGTAGGAGGTCTTGCCCTCCTGTAGGTTCACTTCGTAGTGCACGTTGGGCTCCAGACGGTTGGT
GTCCAGCTCCCAGAGCTTGTTGCACGCGGCCGAGAGGCTCTTGAGCTCGGCGACTGCAACGGCACAAGTCAGCATTATATAGGATTTCTCAGCCAATTCA
TTGCAATTCGCCTACAGTCGGAGTGGCGTTGGCCATGATGCAGGGGCTAGCGACTATCAGCGGCTCGAGGCGATCGGGGAATGAATTGCATCCGTCCTGC
AGCTGGATCGAGCGCACCCACACGCTGTCGTCAGTTGCTGGAACGAATGATACATGTACACACGACTGCAACCAGCGAATCAGCGTCGATAAAACAGCTG
CTGCCACAAGACAAGAAATATGCCAGCCAATCAGTGTCGTCACAACGACAGCTGTATATACTTGTGTACCCGCAAGATACTCGCCAAGATACCTTTTGCT
TTCATGCCTTGCTCGTTGCTGAGCCCAGTTTTCCTCGGCAGACTAAGAGCAGGTCTCAGACTCACGCACTCTTATCTGCAGCATCCAAATTGTTAATTGG
CAAGCTGAGTGTCTTGGTTGTTCCGCTCAACGCGAGCTATCTCACCGTGAAGCGGGACGTGCAGCTCAAACTCAAAACTCAAACACGGCATCGCAGATAC
CACGCCTCGATATAATCGGTAATCGGTGGCATGCAGGCGACAACACGGCCCTGGTTTGACTATCAAGCAATGCATGAGATTCGACCCCGCCTCCACAGTA
ACGCACTGAGGATACACGTGGAGCGATGGAATTAGCCGCCGATGCGATCGCGCAGCGATTGACACGGGAGCGTCTAAGGCATCCCGTTTAACAAGCCGCT
AGCGGCAATGACTTGTGCTTGCAGCAATATCTACAAGAAAGCCTTGTACATGCTCGACTTATAAGTGATGGCGCGCAGCGTTGCCTTGCAAAGCACGCCT
GATGGCTCGAGAAGCACTGAGGGCCACGAGCAAAATGCCGAGCGCACCAGAAACGGATGTCCGTACCTTTGTAACGAAGGCTTCAACACTCTCTTGTCCG
ATAACCTGGCCTCCAGAATCTTCAGTTTGGCTGCATCCGAGCCAGACACACTCATCTTACATCATTTAACTTCGCTCTTTCATCATTTTCAGCATCGTTG
GTGGTTTTGCTAGGCCAGCCTCGATGATGTGCTTGGCCTTGCTTGGCGCCGCTCACCCGCCACTCTCGCACTCGCCTCGCCGCGCCCAGAGCTCCGTCGT
CTCCTGCCTCGCCCCAGCAGCTCCATGTGGCTCCGTCCCGGCGTCCTGCACACGCGCAGACTGCTCTTCTCGTCCGCGTGCGGTCGCTCGCGCTCGTCTC
TGGGCAGTCTGCGCGTCTTCACATCCGCCCGGGGGGCGTTGCAGGCTGCCGCAGCGCCGACTGCCCCCGTCTCGGAGCCCCTGAGCGGCGGGTACCCCAC
GACCGCAGGTATGAAGCCGCCCGTGGACGACCAGCACGCCGTCATCGCCGACTTCATGCCCATCGTGCCGCCCGAGTGTCTGCGCGTGCAGCAGGCCGAG
CAGACGGCGCGTGGCGCCACCGTGGGCCCGTCCTCCTTCACGTCCATGTTCCGCGACATGTCGCCCTACATCAACTTCCACCGGGGCACGACCATGGTCA
TCCACCTGCCCGGCCAACTGGTCGAGTCCAACCTCTTCGGCGCCGTGATGCACGACATCGCGCTGCTCAACACCTTTGGCATCAAGTTGGTGCTGGTGGC
GGGCTCGCGGCCGCAGCTGAACAGGCAGTTGTCGCTTCGCAAGCTTTCGCAGAGATTCGACTGCGGCATGCGCATTACGGGACCCATGGAGCTTCAGTGT
GCCATGGACGCAGCCGGCTCCGTGCGCTTCCAGATCGAGAGCTACTTGGGACGAGGAATTGTCAACTCGCCCGGACGAGCGAGGACGATCAATATTTCTT
CCGGGAACTTCATCACTGCGCAGCCTGTTGGCGTTCGAGGAGGTGTCGACTTCAAGAACACAGGAGAGATGCGACGACTGAACGTCGATAAGGTGCGCAC
TGCACTGGATGGCGGAGACATTGTGCTCATCTCCAGCATCGGCTACAGTGCCAGTGGTGAGGTTTTCAACTGCCTCTCAGAGCAGGTGGCGAGCAAGTGT
GCCATCCAGCTCGAAAGTGCCAAGCTTATCTTCATGCATAACGGCGAGGAGCTCATCGACTCGCGATCCAACTCCATGGTGCAGACTCTTGTGATTGAAC
AAGCGCAGCAGTATGTCGAGTTGGCGCGCCAGAACACGGACATTAGCGGCGATTTCCTGCTGTACTTAAAGGAGTCTATCAAGGCCTGTGTGAACGGAGT
CAAGCGCTCACATCTTGTCAGCCGACACGTGGACGGCGGCTTGCTGCAGGAGCTCTTCACCCGCGACGGCGAAGGTCTTATGATTACAAAGCACATGTAC
GAAGGCATTCGGATGGCCTCTACCAACGACATTGTGAGCGTCATGCGCCTCATCCAGCCTTTGCTGGACGACGACGTGCTGGTGTCGCGTGATCAGGAGC
AGATTGAGAGCAACGTGGACACGTTCACGGTTGTGGAGCGCGACGGTGCGATCATCGCTTGCTGCACACTGCAGCCGTACGAGAACAACTTCGCCGAGAT
GGATGCGTAGCCGTCGACCCGACCTACCGCAACCTCGGCAAGGGCAATGCTTTGCTAGGATATATTATGCGCAAGGCAGCAGCCATGGGCGTCACCAAGC
TGT