Description :
From Genome Similarity Track
Location :
Scaffold_8:343509- 344571
Sequence
1062 bases(100 bases per row)
ATTCCTGGCTATTCTTCTTCCACACAACTGGCACAAGACGGACTACAGTATAGTCGACTGCAATAAGGCCAGAAAATTGTATTCTTTGCCAATCTCGCTA
AAATATATTCCAGTTACGGTTGCCGAGAAAATGTACACTGTGAGAGCTGGACTCCAATCGGTTATGTATCCAAGCAGACGTTGCATTTTCCGAAAACGCT
TTTCTAAATAATATTTGAGATCCTAGCGAGAGTAGGACTTGGAACTTTCTTTAAACGTAACACAGTATACTTGACCTCGAAGAAAAGAAACTGACGCCAA
TTTTATTTGCTTGGTAACTATGGAGCACAGTAACCGTCCCAGTTCTGATGTCACTTACATGCGCATCTTCAGATACGTTGTGGTTTAGGAACAATAGTGC
GGGGGCACAACTACAACTGCAGTCTAGTGTTGTCGACAAGTACTGAACAAGCAAACGTTGCTCACGCTGTCTCTCCGAGCTCTGCAAATAAAACGTATCC
AGTCGTGGGAGAAGGTGGCTCCGCATCACGCAAAACGCTCGTACGCTGTGCTTTGCTGCTCGAATCTAGATTGGGGAACAACGTGGGACCCCGACGTGAA
TGGTGCTATCAACATCTCTAAGATTGCAGTGCGTATGATGCTCGGGTTTCTCAGGCCTCTAGAATTGAGTCGGTAACGTGGATCGCGGGAGGAGATTTCC
TCTACACGCGTTCACACGGTAGAAGTAGTCCGTATCAGGGTGTGTATGCACTCTCTCCTTCTGTTTACTGAATAGTTGTTATAAAGTGAGGTATATTTAG
GCACAATCCCTGACCTTCAATATCCATTCTCCTGCTACATTCAGACGCAACTTGGCTCTACAACAAGGAGTACAGGCCGGTTTACGGCACCGCAGGCGTC
GTTCCGGCCACTCAGACCAGGTAGTTCTGGACTAGTATGGCGCGCTCTCGCACGTCAATCTGAGGATGCTTGCCATTGTCTCGTTTTCGCGGGTTGTCCA
TGTGTCGATGGATCCAATATACTGCGTCGCTGGACATCGATTGCTCGATCTGTGAGACGATG