Description :
From Genome Similarity Track
Location :
Scaffold_60:3435- 9466
Transcript NameFunction/comments
Hyaar_Emoy2807164PREDICTED: Hermansky-Pudlak syndrome 5 protein homolog
Hyaar_Emoy2807165hypothetical protein

Sequence
6031 bases(100 bases per row)
ACTGAGTACACAGAACCGCAAAGTCCGCTTTACTTGTGTGCACGCGTCCGAGAACTTTCTGGCCTGTGGGTACGTCGTGCATTAAATTGATGCGTGCGGG
CAAGGAGTGATGGACATTGTGTTTTCCCACGTACTGATTTAAACGAATGTTTGTTTCTATTTCTATTTCTATTTTTATATGTATCAGATCTAATTCTGGC
AGTGTCTATTTATACGCGACGTCAGCCCTCAGCCGCATTGAGCACGACAGTCGCGTGTCTCTGGCTAAGTACCACCTGGTCAAGATGATTACGCCCCCAA
GCAATGATCGCGTACCGGTCGCGTGTCTCAGCATCTGTCATCAGCAAAAACGTCTCGTCGTTGGCACCAAACGCGGCGTCGTGTACGCGCTGCAGCTCGC
CGAGTACCACAAAATCGGTGAGAAGATCGAGTTCTCGCACGACTTTCACAAAGGGTTCCCCATTACCTGCTTCCTATGGGACAAGCAAGGCGCTCGACTC
TTTTCGGCCTGTAATGCAGGACTGGTGTGTCAGACGGTGCTGCGTGCTGGCATGTCAGCGCTCTTTGGGAGCACGGATACGGAGTTGCTGCTGAAAGAAG
AGACGGGGATCGTGCAGGTACGATGGTGTTAATGCTCCACGTACTTACTGGACGCTCTTTTGTTCCTGCTGCTGCTGTGTTTATGTGGTTGTACTGACTT
GTGTACTGCTAAAAACAATTGGATGATTGGTACAGCTAGATTTGGCACGAAGCAGGTCGTCGCAGATCCTGATGGTGTCGTCGCAGCTTCGGGTGTTGCT
CTTGAATCTGTCTTCTGAGCACGAGAGTGCGGTGCAAATTGGCACAAAAGCGCGACAAGGCGCGTATGGCGCGTGTTTCTTTACAAGCATCAATGTCGAG
TCGATTGATCCCGCCAAGAAACGCGAAATCAAAGTGTTTTCGTCGCGACCAGGACGACGCGTGTGGGTTGCCGATCCGCAGTCCGGTACGGTGTCGTCGA
CGTTGAAATTTTCGCTGACAAAGAGTCCGACACAGTTTTTGCAAAGTCCAAAGTGTGCTATGGAAGAAGGTAGGTCGTTTTGGTACGACGTGATAAACTT
GTGCATTGAGGTATGATGGAAACGCGGATGTTTTGTGTCGCTCACTACTGATGATGTTATTTGTCAGAAATCCAACCTCGAGATTTGTCCATCAATAAGC
TTGGTCGCTTTCAGTTTTTGCAACATCCTTCTTATGCACCACAATATGTCAGAGACGCGACCACATTGCTAGTGAGTTGGAATGCTGGATCGCGCGTGTT
ATTTTTTCTCGACCCTCTTGGCGTAGAAATTGTCGAGTGGCACCTAGATCTGGGTATTATCCACGACCTGACGGTATGAGACTGCTGCATGAATTCATAT
GTGGAGCAATCGTATACTTGTGCTGATTGCGTATATTGTCCGATTAGATCGTGAACGAAACCACGTTGGCAGTCCTTCACGGCGATGCTCCAAAAGTGTC
GTTGATCCAGTCCTGTTCGGCTCACCAATTTCTTCAGATCTACGGTTCGAACGATGTCAAGAAGGCTGTCGAGGTAAGCGTCAAATCAAGGAGTACGTTC
GGTTGTGTTCTGAAGTCTATCTTTGTGTGGTATAGCTTGCAGTCGAGTTCAACTTCAACGACGCTGCCGTCGTGACCTCTATACACGCTCAGTGGCTGGC
CTACCTTGATAATGTTGGCACCAGATCCGTGGAGTTTGACGAGTTGACGAAGTCCTTAAGGGCGCTCGTAGATCAGACAAAGGCACTTGAAGAGAAGTAT
AGGACGGCGGTTCAGGGCGGTCTATCGACAACTAATGACTTGGAGCTCGAGCCTTTGCAACTTATATACAAGCAGCGCCCGCAGCAAGCAACAGCTGTGG
CGACGGCCTCTTCATCTGATTTGTTTGCGGACCAGGAAGAGCCGAGGGATACCGAAGTGACGTTGGCGGCGGGCAGCACTCTGCACAAGCCGATTGAATA
CTTCGATGTACTTGCACCCGCTACTCAGTCCTACTCCAAAAGTGTTTGTACACCCGATGGTTCCTTTTTGGAGGCTAGGCTAATGAATATCCCCGTACTG
CCACCGGCAAAGCCTGTGCTTGAAGACGATTTTCGTGAAAATTACATGGAGGAGATTATGGAGGAAGTCAAGCGATCCGAGCAAATGCGAAGTGAGGAAG
GTGCTAGGAACATGAGTCTTTTACCGACAATAAGGGATGGGTCGACGGCAGCCGTGAAGGCATTTTCGACGTATATTCCGGGTAGCAGTATGCTCACGCA
TCTCATGGATGGGTCTAGGATCCCAGTTGCATTTGGCCGCTCAGATGCGTCCGGCCTCTTTAGTGCTTTCCCGGAATTTGATAATGATGAGTTGACGATC
GACCCAGACCCGCGTTTACTTCAGCCAAGCTACACTCATGGCTACAAATTAGCTGTTGACGCAAACGAATGCTCTGTGCTGCGAATCGCTATGTCTACGA
TCGGAGAAGCAGATGAAAGCAATGTGGACACAGAAGTGCTTTTGGAAGCGATCTCGATGGACATTTGGGATTCAGACCTTAAATACACGTCGAACTTACC
GATTAGCGAACAGTTAAATCTTCCCGAGAACACAGTAGATGGGAAACATATGAATGGGCGCATGCTCGTTGGACAAGATGTGCAGGAAAATAGGCAAACA
GATGATGCAAAACGTGGACGGGACGTTTCACCGCGCGCGGAAGGATCGGATCTGCCCGAGAATTTACACGTAGAAATGCCAATCTTAGCAGCATCGTCGA
AAAATGACTGCACCCCCATTGATAAATCTAATCAACTTCTTGTGCACCGAGCATTGGCGTCTACAGACGAAGTACGTGCGGCTCAGCGGGCTATTCAGAA
GTACTTTGGAGCCGCTCCGAGCTGTGAGGTCAAGATTAGATGTATAGTTGGTGGCCGGATGGCTATATCGTCGGAGTTGGAACTCACCGTTCGACGTGAT
ATCAGCGAACTAACTTCAGAGCTCCACGCGGCTTCTGCTACAGCCGAAAAAACAAAACATCTCACACGGAGATTGTGGCCGGCGTCCGGAATCACACGAG
TGTGTGCATGCCTTACGAGCGTATACTTGCTGCAGGGTGACATGGCTCACGTACAAACGACAATAAAAGCGTGGTTAAACTGCTTCGACCCAACTGCACA
ACATGCCGAGGCCGACGACTGTATGGAAGATAAAAACATGCACCCGAATAAGGTGGTAACTACTGGATTTGCCCGCGGCGAGGCGCTTGTAGACGGCGAT
GGCTTACCGCTTACGAGAGGAGATTGGAACTTAGTGCGAGCGTTGGTGTCCATATATTTTGCTGTTTGGGCTGCAGGATCGAAGCTGCATCTCCACCCTG
TAAACCCAAGAGCCCAAGCTGGTGGCAAGGTTTGTAGATTGTACGAAAGTGAGATGGGGATTGCTTTAGTACTGGAACCGCGCTACAATTGGGACGACGA
GGTAGAAGACTCCCTGACTACTTCAGCCACAGCAGATGAAGCTGAGGCATTTGTAACCAAGTACGGCGTGTACATTAATCCAGAACTAGCCGCTGAAGTC
TGTAATCTGCGGCGATTCACAGGCGCGCTGACAACTGTGCTGGATGGCGCTGTATCCAGCGCTGACATGGCGGATATTTATAATGAGATTGTGGGATGGA
TATCAGAGGAGGAAATTGACAAGGCTGTTTCGGCATTGAAAGAGCATGACTCGTTGTGCCTGCTACTCGACGTACTCGACATTTTATTGAAGAAGTGTCC
GCAAGAGACAATCGACATATCCGTATGCGAGTACCCCGTGTTATATCCGTGGAACGTCGAGCGAGCTCTGTTCGGGACAGAATTGGACTGGGAAGCAATT
GTTGGAGGGCTAGATGGTACGCGTGAAATGTTGCTACCAAACGCTGTAGGCCAGACGTCGACGTACCTTCGATATCTTGTACGGCTTCTTGAAAAGAGAG
GCGACGAAGCTGGCAAAGACGCGCAAGTGGTAAGACGCTGTTTAGACTTGTGTTTTGCAAGCAATGCCGTGTTAGGAGACTTGTTTGATCACAATGAAAG
GCGTGCCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN