Description :
From Genome Similarity Track
Location :
Scaffold_540:3435- 5796
Sequence
2361 bases(100 bases per row)
AAAAAAGTGTTTCGCCTGTACTGGCATGAACACTGATGTTAATAGCAAACTCCACGAATGGCAAATGTTTGCCCCATTTCTTGGAATTGCTATTGCGCAC
AATGATATCCGCCACAACACGATTGGACCTTTCGGTCTGGCCATCGACTTGGGGATGATCGGCGGTAGACATGTGGAGCTTGCTCCCAAGCAGCCAAATA
CATGGCGCCAAAATCCTTACGTAAAACGTGGATTCTAGTCCGAAACTATGGACTCGGCCATTCCGTGTAGCCGATACACGTGATCCGGGAACAAGAAAGG
TGCCTACTTGCCTGAGATTTTGGTGCTACACGGTGCTAAATGCACAATTCTTCTTAGTCTGTCAAAAAAGTCGACGAGAACAGTCTTTCCTTTATGGTCA
GGCGGCATGCCAAACATGAAGTCCAAACTGACCGACTTCCAACAATCAGCTGGTATCGGTAGTGGCTTCAGGGGAGCACTAGTAGAAGGTGCAGGCTTTA
CGCGCTGACACTCTTTGCATGATCCAATATAATTTGCTATCCACATATGTAGGTGTGGCCACCAAACTCCATCTGACACTCAGAAGTATATCTTCTCACA
GCCCAAATGACCACTTGATGGTGCATCATGGAGCTCGTAGAGAATCTTCTGTTTGAGATATTTGTCATGGGGGACATAGATTCTTCATGAATTCCAAGGT
GATGGTTGATGCCATAACAGGCCATCACTATAACTAAAGCGGTTAATCTTTTCCTTGAGGTGTGACGGAAGATTAACTTTTCGTCCACCAAAGTGATCTA
AAAGCAGACGACAATATTCGTCCTGCATGTAGTTCTCCTTTTTATCAGAGGCCAGAGTGTTTCGAACATGGTCAACCCGTAGGGCTGCCAGTGTGGACGA
CTCAATTCGTGCTTTAGTACGAGAAGCGTCTCCAAGGTGTCATTTTTTGAAGTCTGGTCTGCGCGATAATGCGTCAATTAAGACATTCGACTTTCCCGGC
TTGTATTCAATTCGAAAATTATATTCTGAGAAGAATGTGAGCCACCTCGCCATCCTAGGTGATAGGTGCGGCGAGTTTATCACTGTCCGCAATGATGCGT
GATCCGTGTAAACTACAAAATGTTCGGTGCCCAATAGGTGCACTCGAAACTTAATAAGAGCATACTGTATAGAAAGTAGCTCCTTGTCGTGCACGGGATA
ATTCAGCTCCGCAGCCTTTGAAGCCGGGACTGATACGATGTGACACGGTCAATACCATCGTCATCCTTTTGCAAAAGCGCACTGCTGATAGCGAAATAAT
CGCATCGCTTTGCCGCGTCTGGCAAAGCCAAGACCGAAGCCTCTACAAGTGATCGCTTCACTGAAGTGAGAACATCTACTTGAGCCTCGGACCAAGTCCA
CTCTGCGTCCTTTTTCAGGAGGTCAGACATTAGTTTGTTCGCTCTGCATAATTGTTGCTATATTTGTGCAAGTAATTAGCAAGCCGAATGACTTGACGCA
GATCCTTCACATGTCGTGGGACTGGCCATTCCTTAATCGCTTTAACCTTCTCTAGGTCTGCTTTAACACTGTGTTTCCCCACAATGCATCCCAGTACAGG
TACTTCGGGGACCCCTATGACGCACTTTTGCAAGTTGACGTACAACTGGGCGTCGCCCAGAGTCTGCAACACAACGTCCAAATGACGTTTGTGTACTTCA
ATCTCACTCAATCCGTCCTCTTCCCTACTATGAACAAGCACATCGTCAAATTTATGAGGCGCGTAAGCACGGTGTGGTCGAATCACGTGATCGACCACCC
GGTTGAATGTCGCTGGTGCATTTTCAAACTTTGCGGCATCACTAGCCACTCCCACAGCATACCGCTTGGGGTGCTAACTGCCGTCTTGGCTACATCGGAC
TCATTCATGAGTACCTGATAGTAGCCATATTTCAATCTAATGCGGAAAATATAGTTGACTTCCCCATTGTGTTCAATAGGACATCTTTCCGCGGGACCGG
TGTCTGCGCTGGGATGGTGGCCGTGTTAAGTTTATTGTAAGCATGAACTACGCGCTAACCACCTGTTGCCTTACGCAAACAAAAGGTCGGGCTGCAGTGA
GGCGATTTGCTCTCATGTACATGTCCCACCTTGGCTCTCTCGTCGAAGAACTCGTCGATGTAGTCGACCTGCTCCTTAGACAATGGCCACTGCCTGGCCA
CACAATACTTGGTGCCATTTTTAAGTCAATCTCGTGCGGGATACCCTTATCGGCTACTAAGCGGTTCAGCACTTCTGTAGGAAAGACACCACGGTGCTTC
CACAGAACTTCGTAAAACGGACTGTCCTTCGAGGCATACCAGCCTTGAGCAGCGAATTGTT