Description :
From Genome Similarity Track
Location :
Scaffold_1:343480- 346910
Sequence
3430 bases(100 bases per row)
GATATGCTGCACACCATCCGCTTCTGAAGACAATGGACGTGACTCTTCTATGCACTCTGTCCATTTGTGTAAAGACTCGGCTCTCGCACCTTCAAATCAT
TGGCGACCGCTCCTCGATTGCTGATTACGAAGGAGCTTGTTGATGACAAGTCGTTGTGCAGTTCGAATCGAACGCTGGATGCTCACGGTAGAAGGACGTG
ACACGGCCGCTGTATTGGTCATTGGATCGTGCTGGAAGAATGGTTAATTCAACAGCGGAAACGATATCGTAGCTTTAATCCTACTGATACGACGTCGTTT
TCTCCGAGACACAGTCCTGGACACAAGATACAACATTCCTAGCTGTTTCGGCTAAAAAGTCGTTCTCGATGATCCCAAAGGGTGTAGGGACGCAAGTCAA
TCAGTATGCAAGAGACGCATACTGCAAAGTCTACTGTTAGAGACGTACGACCTCTAGGCTACAAATCCCGAAATTAACACCTGGCACTTCTGACGGAGAG
GGCCTCTTCCTTGGTGTCGGCTTGCAGTAGCGACAGCGGGTGACGCATGACGACCGATCACCAAGTCTCAACCAGGTCATCTCTTCGACAAAGTTGCGAG
AGTGAAGCAGCTCCATGTGGTTAAATATGATGCCCATCCCCGGTTTATGGCGTGTTAAAGGACAATCGTCATCGTAAAGCAGTAACGAACGTCTCCAAAA
GCCTCCACGGACTCGTAATGTTAGTCGCAAACGCATTATCACTATCCATCTGGGGGTAAGTAAGGGAGCTCACCACACGTTACATCTACAAATTGAACGA
GGTGGAGATTTATCTCGTCGGGAGCAGTGCGACCATGAAGTCACTTATGCTACGCAAAAAGCTAGTTTTTACGCCACTATCATTACTCATGTTCCGATAA
GACGTTAGTCTTCGTCGCGGATACATGTCGCTTTATGAGTTTAACGTCACTTATGCATGTTGTCGGCTCAGTACGGACTTGCTTGCAGCTGAGATCGTTT
GCTCGGCTAACGAATCGCAGTACAACCAGTCGTATACTGTGATACTATAACCACTAGCTTGCTTTTAGTGTCGCCCTCATCAAGCGCTCCCTCCGATATG
TAAGGGGTTGATGGAAGGGAATTCTAACAACTTAGCTCTACGAAGTACAGCAAGCGTGGGCAGAAGGATGGATATAGCAATTGCTGAAGAGTACCAACTG
GAGTTTTCGAGAATTTGACAGTTGTCGCTTCTGTTCTGGAAGGGGAGACCCATCCGCAGCTGAAGTGTTCGTAGCCACTCGTATAACATACGCCCATATA
AAAAGGTGTCCTTGGGTTATGAGCCAAAAAAGTAGATTATTTCACTCGCTGTGTCTTGCACTCTATTAGTATCGAAGCCATCCTGAAACCCCCTGCCTTT
TTTGGCGTGTGTAGAAGCGCAGAATTATTGTTGTTATGTGAGACTTCAGTGCCGGTCGAGTCATGCCATATAAATGTTTTAAAAATTCCGTATCTGGTGC
TCCGCCATGGCGGGAGCTCAAAGACCGCCGCGTTCAATAACATTGTCGGCAGCATGATCTTAAGAATCATTACATTGGCTAAGATTTGTTCTGTTCGGAA
TGTAGATTTCAGCCGAAAACCACCTACGTTGTAACGGGACACCGTATCAACACACTGGACAACCAGTGTGGAGCTACTATCACCGACAGCAGCGTAAGTG
GTGCCTCGCTACCTCTGTTAATTTGGCAGAGGGAGGGAAAGCAACCAGGAACTGACTAGTTGCGGGTAAAAGTAAAACTGTATTAAATATAATTAAGTCC
TAATCATTAACCTACGTTTCAGTCCTAACTTGATTACATTTATCTACAAAAATGTATACTAAAGTCTTACTCACCACTCATTGCGCGCGTCCATCGTTGA
TTTGTACCACTAGAGCTGGCTGATATGATGATCCATATCATATCGCTGAGTGTTTCTGAATATTACCCCTTATAATAATATTCACGAACATTATCAACCT
TTATGATGATATTCTAACTAGCAAGTATCAAGGGTTAATTACATGTAACAGGCTCACCCCGTTACATCACCCCCCCCTTAAACGATAGTCACTCAATCGC
TATCATGTTGATGTGGTCACCGTTAGACCGCATCAGGGACAGGGATCACTTGTTTTGGTCTGATCCATTCATTTCTGGATTTTCATCGCATAATGAACAA
CTCCATGCGATGCGCGGCGAAAGCTACTAAGAAGGCAGCTGCGCGTGTTAACGCAGCTGCTCTTGAAGATGCTAGTCTGCTAGCGGCAGATGCACGTGGT
GACTCACCACGTGCTAATGATGATGGCTCCCAAATGGAGCTTATCTACTCGGGGGAGTCGGAAGGTGGGTCTGACTCGAAGAAGACACCTAGGTCACCCG
AGTCTATAGGGACGGCCGAATACGAGCCTACGAATAGGAATCGAGCGGGTAGTCAGACTCATGGTCACCACCAGAGTCTGTTTAGTTCGGAGGATGAGCA
TGCTGACTCATCCCCCGCGCCTGCTACTGCGCATTCGCCTTCTAGCAAATGTGGTGATGACTTGAACCTTCGTAATGACGATTCTAGTGGTACTAAGACT
TCCATTGGTACCACGCAGGAGGCTCTAGACGGCAATGTGCTGCGTCTAGCCCCTGAACACAAGCCTTGGGTATTACCAGAAAAGCTTGTGAATGACCTGT
CAGGCGAGACAAGTCTCCATCATCGAATTCCATTATTCGATGCGAGGCTGTTGCACAAGCTCGACATCAGCGCTAGTAACTTTCGCGCTAAAGAAGAATT
CTATCTGGATGCTTTTCTGAAGCATCGTTGGTATAGTGGCAATACTAAGCGAGACAAAAGCTCGTTGCTGCAGGCGTGGAACGCCTTTATAGTCAATGTG
CAGCACATTAGGCGCGAAGCTTGGCTTTGGAAGCTTGACACAGCTCGAGTTAGGTTTAAGAAACGAACCTTAACTGATGCAAATGCCAGGTTGCACAATC
TGTCTCGTTAGGCAGGAATTACATGCCTCACGTGAGGCGACCCGTGTCCGTGTTGTTTCGACAACACTCAACGCATCCAAAGGGAGGTGCACTCCCTTTC
TTCGCCCTGGGGTAGGGTGCACATCTCTTCTGAGATGCGCGATGTGATTGCTAACCTATTATCGCTCTACCAGCGCCATGGGCGCGTGTTTTCCAATGGC
TCTTCTGAGCCATCGTATGTGTCTCGTCGTACTGGTGGACAAGACCCTCAACGTCAATCATCAGCTGGGCGCCTCGCGCCCAGCTGTCGTGCGACGGCAG
ATAGCCGCGCCAGCGAACAAGATAACTCGTTCGTTGCCCCTTCATGTCACGGTGGTTCAAGATACGCTCCACGAAGCGTTGACCACCGTGCGAGTCCACC
CATGGCTGTGGTGGGGGCGGGAATATTAAC