Description :
From Genome Similarity Track
Location :
contig_47:343469- 347372
Transcript NameFunction/comments
g9252.t1GAY03874.1 Hypothetical protein PINS_011706 [Pythium insidiosum
g9253.t1XP_009523414.1 hypothetical protein PHYSODRAFT_313245 [Phytophthora sojae

Sequence
3903 bases(100 bases per row)
CTGGGTAAGTGGCTTAGCCCACGCGTTTCCAGTCGACTGGGAAGACTGTGGGGCCGGAGTGGGAACACCACCGGGCGGCGGGCCCCACGCAGCGCCAGGG
GGAGGAGGCGGCGCCTGGCGACGGACTTGCGGGTTTTGAACGCGTGCGTGGCGACCACGCATGATGGCCTGGATCTTGGTAGCTGCCTGCGCATCTGTCA
ACGGTAGAGCCTCCGGGAAGGCCGTGCCGATCTTCGTGTCCTTGCCCCGGCCGAAGCTGAAGCACTTGATGTTGCACAGGTACGGGCCGAGCTGTACGTT
GTTGTTCTCCTGGCCGTTCAGGTAACACATGGTGTACAGGGCCATCTCGAACTCCGGGCTCACTCCGATCAAGCTGCAAAATGCCACCACATAGTCGTTG
TTAGTCACGTTGAATGTAGAAACCTTGATTGCAGTAGCCAAGTTTCACCTCGTGGACACGGGCTTTATCTCGTCTTCCCACTGGAACTGGAACGTGATCA
ATTGCTCCTTGTTGTGGGGCTCCATAAACTTGCATCCGCGCTGCTTAGGGCGAATGTATCCCCTGTAGTCGATGCGGCCGTTGCGCTCCTCGTTGTACAC
CTGGAGCCAATTGTGGCAACCGCACACTTTGCCCTGCTCGGCGAACAAATCCATTAGCAACAAGACTAAATCCACTGATCAGATAAATCATCAATCTCAC
ATTCTTCTCCTCGCCAACGAACACGTGCTCAAAGCCCGACGAGTCGTTGCGCACTTCACGGCGGTACAGCCCGAACCAAATGAGCTCGAGCTTTTTCTTG
AAGTCCCCCATGTCGCCCGTGAACTTCTTGTTCTTGACCAGCCAACTGCAATTGACCGCATACAGTCAGAACTACATCCACACCCTCACCGCCATCACCG
CCATACTCACGCGTGGGCATAGCGCATGGGCGCCGTCTCAAGCACAGCGTTCAGGAACGCGTTGTTCTCCGCCAACTCCTTGGGCGTCACGCGCTCCGTC
ACACCTGTCTGTGTATCACAAGGAGCCAATTACCACATAACTCCAGTCACGACTCCACTCTGTTCATTGCACTCTCCAAACTGGTCGCACCTCGCGCTCG
TAGTTGTCCAGCAGGTCGAAGAGCAGCTTGTACGTGCGGCGCTCGAAAACGCTCGGGTCCACGAACGTGAAGAGCGGCTCGCGCGCCGCGTCACCGCGGG
CGTAGGAGGTCTTGCCCTCCTGTAGGTTCACTTCGTAGTGCACGTTGGGCTCCAGACGGTTGGTGTCCAGCTCCCAGAGCTTGTTGCACGCGGCCGAGAG
GCTCTTGAGCTCGGCGACTGCAACGGCACAAGTCAGCATTATATAGGATTTCTCAGCCAATTCATTGCAATTCGCCTACAGTCGGAGTGGCGTTGGCCAT
GATGCAGGGGCTAGCGACTATCAACGGCTCGAGGCGATCGGGGAATGAATTGCATCCGTCCTGCAGCTGGATCGAGCGCACCCACACGCTGTCGTCAGTT
GCTGGAACGAATGATACATGTACACACGACTGCAACCAGCGAATCAGCGTCGATAAAACAGCTGCTGCCACAAGACAAGAAATATGCCAGCCAATCAGTG
TCGTCACAACGACAGCTGTATATACTTGAGTACCCGCAAGATACTCGCCAAGATACCTTTTGCTTTCATGCCTTGCTCGTTGCTGAGCCCAGTTTTCCTC
GGCAGACTAAGAGCAGGTCTCAGACTCACGCACTCTTATCTGCAGCATCCAAATTGTTAATTGGCAAGCTGAGTGTCTTGGTTGTTCCGCTCAACGCGAG
CTATCTCACCGTGAAGCGGGACGTGCAGCTCAAACTCAAAACTCAAACACGGCATCGCAGATACCACGCCTCGATATAATCGGTAATCGGTGACTTGCAG
GCGACAACACGGCCCTGGTTTGACTATCAAGCAATGCATGAGATTCGACCCCGCCTCCACAGTAACGCACTGAGGATACACGTGGAGCGATGGAATTAGC
CGCCGATGCGATCGCGCGGCGATTGACACGGGAGCGTCTAAGGCATCCCGTTTAACAAGCCGCTAGCGGCAATGACTTGTGCTTGCAGCAATATCTACAA
GAAAGCCTTGTACATGCTCGACTTATAAGTGATGGCGCGCAGCGTTGCCTTGCAAAGCACGCCTGATGGCTCGAGAAGCACTGAGGGCCACAAGCAAAAT
GCCGAGCGCACCAGAAACGGATGTCCGTACCTTTGTAACGAAGGCTTCAACACTCTCTTGTCCGATAACCTGGCCTCCAGAATCTTCAGTTTGGCTGCAT
TCAAGCCAGATACACTCGTCTTACATCATTTGCCTCCGATCTTTCATCCTTTTCAGCATCGTTGGTGGTTTTGCAAGGCCAGCCTCGATGATGTGCTTGG
CCTTGCTTGGCGCCGCTCACCCGCCACTCTCGCACTCGCCTCGCCGCGCCCAGAGCTCCGTCGTCTCCTGCCTCGCCCCAGCAGCTCCATGTGGCTCCGT
CCCGGCGTCCTGCACACGCGCAGACTGCTCTTCTCGTCCGCGTGCGGTCGCTCGCGCTCGTCTCTGGGCAGTCTGCGCGTCTTCACATCCGCCCGGGGGG
CGTTGCAGGCTGCCGCAGCGCCGACTGCCCCCGTCTCGGAGCCCCTGAGCGGCGGGTACCCCACGACCGCAGGTATGAAGCCGCCCGTGGACGACCAGCA
CGCCGTCATCGCCGACTTCATGCCCATCGTGCCGCCCGAGTGTCTGCGCGTGCAGCAGGCCGAGCAGACGGCGCGTGGCGCCACCGTGGGCCCGTCCTCC
TTCACGTCCATGTTCCGCGACATGTCGCCCTACATCAACTTCCACCGGGGCACGACCATGGTCATCCACCTGCCCGGCCAACTGGTCGAGTCCAACCTCT
TCGGCGCCGTGATGCACGACATCGCGCTGCTCAACACCTTTGGCATCAAGTTGGTGCTGGTGGCGGGCTCGCGGCCGCAGCTGAACAGGCAGTTGTCGCT
TCGCAAGCTTTCGCAGAGATTCGACTGCGGCATGCGCATCACGGGACCCATGGAGCTTCAGTGTGCCATGGACGCAGCCGGCTCCGTGCGCTTCCAGATC
GAGAGCTACTTGGGACGAGGAATTGTCAACTCGCCCGGACGAGCGAGGACGATCAATATTTCTTCCGGGAACTTCATCACTGCGCAGCCTGTTGGCGTTC
GAGGAGGTGTCGACTTCAAGAACACAGGAGAGATGCGACGACTGAACGTCGATAAGGTGCGCACTGCACTGGATGGCGGAGACATTGTGCTCATCTCCAG
CATCGGCTACAGTGCCAGTGGTGAGGTTTTCAACTGCCTCTCAGAGCAGGTGGCGAGCAAGTGTGCCATCCAGCTCGAAAGTGCCAAGCTTATCTTCATG
CATAACGGCGAGGAGCTCATCGACTCGCGATCCAACTCCATGGTGCAGACTCTTGTGATTGAACAAGCGCAGCAGTATGTCGAGTTGGCGCGCCAGAACA
CGGACATTAGCGGCGATTTCCTGCTGTACTTAAAGGAGTCTATCAAGGCCTGTGTGAACGGAGTCAAGCGCTCACATCTTGTCAGCCGACACGTGGACGG
CGGCTTGCTGCAGGAGCTCTTCACCCGCGACGGCGAAGGTCTTATGATTACAAAGCACATGTACGAAGGCATTCGGATGGCCTCTACCAACGACATTGTG
AGCGTCATGCGCCTCATCCAGCCTTTGCTGGACGACGACGTGCTGGTGTCGCGTGATCAGGAGCAGATTGAGAGCAACGTGGACACGTTCACGGTTGTGG
AGCGCGACGGTGCGATCATCGCTTGCTGCACACTGCAGCCGTACGAGAACAACTTCGCCGAGATGGATGCGTAGCCGTCGACCCGACCTACCGCAACCTC
GGC