Description :
From Genome Similarity Track
Location :
Scaffold_11:343336- 349843
Sequence
6507 bases(100 bases per row)
CTCCATCCGACATTTAACGTCGGGCAGCCGAAGCCCTACAAGAAGCACAGTCAATCTAGTCTAGATGGCTCGATGACGGCAAAGTGGCGTGAGTCAGCTT
CTCGAGCGCAACGACTTGGTCGCGCAGGCGCATCACGTCCGATCCAAGTGCGACTCGTATGTTCGAAGCGGTCTGAGCGAACTGAGCCTTCTGTACCTGT
TGTAGGGCAGCGAGCTCAGAGCTCTGGGATTGTTCCTGAGCGATGACACGATTAAGCAGAGCGCGAGAGCCGTGGTAAACCTGGGCTGACCATTTGAATC
TTTCTGCCTCCGCCATCGCCGCTGCGTGACACCCACGGCTCGATAGGTTGGCTTGTTAAGCCCCAAAGACACACCGAGATCAGATTCGGCTTCGTATGCG
TTGGAGAGAATTACCTTCCTATCTAGATATATGGGAGGCACCGGAAGGCTTGATGAGGAAGTTTCGGAAATGGTGACGGCGTACGAGGCTGGGAGCCGTG
TGCAGACATAATGCCTGCACTAGAGCTGCGAGTGCCACCAGCACGAGGTGCATCGCGGTGCTCAAAATGAGAACGAAGCTTTCGCAGAGGAGCGGGTACA
CGAGAGTACCAACATGGTATGTTTCGTTGGTATTAGCGACCACGGTCTAGTCAACAATGCAATAGGGCCTACTTTAAGCCGACTACTTCGGCTTGCACGT
TAGTGCAAGGGTATGAGGAAGCATAAGTTGCGTTTCACTTAGACTATCTATGCTTCGCTCAAAAGTATTAATTTACTTAAACAGGAAAGCACAACCGATT
TCCGGAACTGTTATATGTTTGCTTGGGTCTTCCTCCTAATTTAATATAATAGATGAAATGTAATTATCAGCTAATGTCTGACAGAAGCATACTAGTCTAA
TTTGTAGAAGACATTGACTTTCAACCAATGAATGCGTTAAAAGAAAGCAGACAACACTCTTCCAAATGTAACCATTGGTGTACCTCACACCAATGTGAAA
AACCTTACAGTATCCAAGTGGCTACGTGTAGCCACTTGCGTGTAGACCCCCCCTCCCATAACGATAAAACTCTCTACTCTTAACTCATCGTTCAAAGTAT
TGACAAGGCCGTCAAAACGTTTGAGAAACCCAACGATGCTCCGGACTCTCCTGAATCGAAGTGTCTGCGTGTGAAGAAGAGGTACAGCCACCTGTGTCCG
TACACCGAGTGTACTACTAGCTGCCCATCACTACCTTACATCGGGTTGAGAGAGCCAAGTCTCTCTGGGCTTAGATCCGAGGTGTGTACAACCTGCACAT
CTATCAGGAAGACTTAGCGCTCTTCAGTAGGGCATACCGCCTCTACAGATGACCGTGGAGCCTTCGCTCACCAGGCCGTGGCCTGCGCCACCGGACCTTG
GGTCCACGGGTTGTATTGTTCTCGAGGACTAGCGAGGAACTTCACGCTGGTAGTGCCCATGTCCAACGCATTCGTAGCCGCGGCCAAAGCGTTCGTTCGA
GCTTAAGACCATAAAACGAGACTGTGGTGCGCACCGATAACATCAGAAAGCGTGACAGCAGACGCAACAGCGTCATTGTTGCAATGCTCCACCTTCTGAG
GAACGCCATCCTCATCATGGCAATGTTCCTCATTCCGAGGAGTGCCAGCCTGTTCGTGGCTGTACGCTTCTTGGAAAGTGATTCAAATTGCCTCCTCCAT
AGTTGTCGATTACACCCGGAATAGCTGGGTGCGAATATGACCGAGATTGAGGCTGTCCATGAAGCATGGTATCTTGATATCTGCAAGCAGAGGATTTCCT
GCCAGAGATGCCCCAACGTGCGCGTCTCTTGCACGTACTCGTCTAGCTCATGTTTAGCTTGCTTAGATACAAAAAAGCGTGGGCTCTGGCAGAACTTGAA
GTTTGCCGATCGGAGCGCGGCGCAAAGCTGATCACACAGCCGAGCCCAGGGTGTAAAGCATCCAGAAAATGTCGTCTCGAATATGTATACTCCGTGCTTG
GCACGTCCACCAAGGTCGAGCAGGGCCAAAGCTACCTGAAGTGGATCGTCCGAAATGACGCCTGCCTTCATGACGATCTCCACCTCACGGGCTCAGGAGT
GAAGGCTCTCTCTTTCTTCCTCCTCAAACGCGGGGACCTCCGGTCGTATTGGCTTAGGCCTGGTTGTCTGTGAAGCGACCATCGAGGCCTCCAAACTCCC
GCAGAAGTGAGTGATAAAACCACGCTCGTAGGTCTCAAACGCAGCCACGCGCTCGTGTTGCCCGGCAGGCGTTGATACCACCAAGCGGCGAAGGACATCT
CGTCCAGAGATGCATCCCATCTTCCGAATATACTCGCACTGTGAGTCGTTCAAGTGAGGAAACTCTCTTCGGTCCATCGTGGCTCAAATGTAGAGCAAAC
AGAGGATTCAGGTTGCTCAATCTAGCCACGAATGTGTAGAATTGACTACGAGCGCTACCAAGTGTGACAGGGTCACACAGTTCTTACACAGAGGATATGC
TTAAGGGTATTCACTACGTTAGTTCACGTGCTCCCGGCCTCAAAGGGAGCGATTTGCTACTTCCACGAGTAGTTGTTAGACTGCTGTATTTATAATTTGG
CCTATTTACAAATAAGAGGTGACCTATAGTGGAGCAAAGTAGTCATGCCCCGAGACAAGTTGGTACCGTGTACCAGGTGTCGTAACGGGTACTCTTTTTG
TAATCTGGTTGTACACTGCCTTACACCCAACTTGATCCTCTCATTAGTGCATAGCGACATGAAAATGACGGATATTGTTACACGGAGGTGCGAAGCTATT
GCTTAAGTACGTTCTGACTCGTCGACTGAAGAATGATCATCTACTGTTTGCTCCTTGATTTCCCAACAAAAGAAGTCAGATCCACCCTCATGAGATATAA
ATAGAATAGTAAGGTCTTTTTTGCCAGCCAGCCGACCTAATTTACTAGAACTAACTGTGGAAAACCGATCGGACAGTGCGAATTTGCAGTCAAATCTTCC
ATTAATATGGCTTCGAGTAGATGTTTGTGCTTTATAATATTTCGATTTGCTGCATGCGATATGCTCGCTGTAGCTGAAACACGCTTTGAGACCCCAAGAC
AAGATGGGCCTGGCTCAATGATGTAATTTCGGTTTGATGAAATATTTTGTACAGCTCCTCATAATGATTTCTCTATATAGAATAAAATATTCCGATGCTA
TTATTACAGAGAGGATAGTCTGAAATCTGAGATACTACGTAGCAACTAGGGATGGGTTGCGAAAATAAAATCCGATCGATCGATTCGATCAAATCCGATC
ATGATCGATTGTGATCCGATTGGCTGATCTATCGATCACTTTCGTTCCGATCGGATTCAATCGGATCGGATCGACAAGTTCACAGCCTTGTGTAAAAACG
TTTTTAGGCCAATATATTTTGATTATACAAAATCTGTCATATTTGCTATAGACTCCTAGTTTTTGATACTCCTGCAGCAGGTGTATCAATAACAGGAGTC
CTGCATCAGTAACCGGAAACCACAACTGTTAAGCAAGGACGAAGCAGCTGATCCCGTCGAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACCTTCTCCAGCCCCTGGTACAGCTAGACAGCCGCGG
ACTCCACGTTCCACACGACGTCGAACATCACCCCGAGCTGCATCTCCTGTTGGTCAACCTGAGCAGCAGATACCAGCATCCCCAGCGGACGCTACTTCGC
ATCAATATCAGCTTGTGGTTCAACCTAAGTTGCAGCTGGTGAGTTTTGACCAATCATTTCTAAGTGTTGATTTTTCAGACTATCCGTCAATCACCCTCGG
TATCCAATTTTCACTGGAATTGGCAATATACCGTGAGATTTAAAGGAAGCAAAGGCGAAAGCGAGCACGCACGCCGCGTTTCTTATGCAGCTACAAGTGG
AGATGCTGGAAATGAAGAAGGAAGACTTTGCACAGGCAAGAAGTCTATAGCATGATGACATACAACATGATATCCTACAACATGTTAGCATACAACATCT
TGACTTGTGTGTCAGCGAGAGCCCCAGTCTGAAGAAGAAATATCCATACCGCGTGCACTACTATTCGATCGCGTGCCTCAAGAAAACCTCGATTACTAGA
TCGTCAATGGCCAACAAAAACGCCCCTTAACGCCAGTGTAAGGCTCGCTTAAACCGCAAGCGCAACGTGGGCGAGAGTCGTGCGACAAAGTATTATTGCT
CAGGATGTAGTCCTTTGGATAAAGCAAGGTAATGCGTCTTTTGTGCTCGTTTGATGGTGGGTTATTGCTAACGCAACGATTAGAACGTACTTGTGTAATA
AGGTGTGGCCCCATACGAAAAATATTACGCTCACCTGCCATCAAATATGACATTTTAAATGGAATAACGGCACGAATCGACCGCGGCCACGATGTGGACG
CGATACCCAGAATCGCGAATCTAGCGGAGGAGCAGGGAAGCGCAAGCGTCACCGGCGGTCAATCAACAGCAATGACGCAGAAGATTTTGCGGAGAACACG
GCAGCGGACAATGTGAATGACGAAGACTGCATTGCGGTGGATAACAGCCTCGATTCTGGCGATGATGACGAGTGCGCTACTGATGAGGGTTCCGCTGAGC
AAGGACTTACTGCTATGGAGGGCGATCCAACGACTGGCACCTTCCAGGTCGACACTGTGTGATCCGGGTTGTTTTAGCAAACCCGTAACAATCCATTATA
ATTTTATTAATGCTCTTCGATGATCTGGCTTGCGCCGCAATTGATTGGTTAAAGTGGATGCTCTTTATCTTGATAAAATGGCCGATGCGCATTTGCTCTG
ATGTCCACTTTATGTGTCACATGTTATGGGTAGGGATGGGTTGCGAAAATAAAATCCGATCGATCGATTCGATCAAATCCGATCATGATCGATTGTGATC
CGATTGGCTGATCTATCGATCACTTTCGTTCCGATCGGATTCAATCGGATCGAATCGACAAGTTCACAGCCTTGTGTAAAAACGTTTTTAGGTCAATATA
TTTTTATTATACAGAATCTGTCATATTTGCTATAGACTCCTAGTTTTTGATACTCCTGCAGCAGGTGTAGGAGTCCTGCATCAATAACCGAAACCACAAC
TGTTAAGCAAGGACGAAGCAGCTGATCCCGTCGAGGCGTTGGAGTCCGCGTCGAATATCAGCATCGGCCCCGGCAGCGCCGATAGTATCGCTAGTTTAGG
ACGCAGGAGCAACCCGCGGCGTGTTGTCTATGAGGGCAGCGAGATCGACAGCAGTGACGCACATAGAAACCGTGAGAGGATTTAAAGCGCAGGAATTTGC
CAAGACCACTGGAATGAACTGCTTATGAGACGAGGTGACGCTAGCGGGTTTTAATCGACAGCCGCAACCGCGCTGTCCATGTCATCGGGTGTTTGGCACA
AAAGCACGTTGTCGCTGTCGGCCGAAACCATGTCCTTAGGTATGGACTTGCTGCCTGTAGAGCTCCATGGGGATCCACTCGTACTGATAAACGCTGTAAA
CCCTTGAATCTGCGCGAACTGATCTTTGGCTACGTTGAAGTCCTTGATCTCGTTGCCCTGGATGTATAGCGATTCCAATCTGCTCGTGTTGAGCGACGAC
CCCGGAAAACCGTGAGAGCGTTGTGAGACAAGTACACTCCTTCAGTGCGGAGTATGTGCCGTCCACATACTCGGTGTGGATGCTTTCCACGACAAGTCCA
GGTATTGGATCCAATTCGCGCATGAAGCTACTGCTGAGCGTCGAAATATTGCAGTCGCGCAGCGTCAGGTTCATCACAGTAACCGGCACGAAGGCAATGT
TCGTCTTCGCCACGGAGTTCAGGTCAACGTTGTTAATCGAAAAGTCGAGGTGTTCGTGGAGTTGCTGACGACGGTCAATGAAGAGCTGGAAATCACGCGG
TTTTCGTTGATGGATGCAATTTCAGCTGAAGAATCTCCAGTACCTTCGATCTGAAAGCTGTACAAACTGGAGGGGACCCAAATGGGACGGAAGGCGGTGA
GCACCAGCTTATCCTAGGAGTGAATGCGTCATCGTCCTGAGCATATTGGTTCGCACTCGGTTCGGCTTGCGGACATGCACATGTGGCAGTTTAATCCCTT
TCGACCTGCACCAGAAGTGCGAATTTTGCAGCAACATACTATGTCGTGAATTCTACTGTCATTTATGAGGTCTGTAGTGACTGCTCGGACCTGTATGAAG
TGGAGGAAAACAAAGTATCCAAGAAGAGACTCTGTGTACGTCATTAACGTCGACTCGTGCATCTTCGAGGACGAAGACTTCATGGCTGCATTAGGTCCAG
CAGTGATCGACGACGACTACGGTGAAGATTTCGTCGAGGACTACGAGTGTGAATGTGAATGGCTCTGAGTCAATTGGGTGTCTCGAGTGTTCTTGGATTG
AGACTGG