Description :
From Genome Similarity Track
Location :
contig_37:343310- 344319
Transcript NameFunction/comments
g8948.t1hypothetical protein

Sequence
1009 bases(100 bases per row)
GGCAGGTCCAGCCGGTTGAAACACGCGTAGCTGCGCACGAACTCGTCAGGCGCGCCGACGATACCCCGGATCGTGAACAGACACACCTTCCCGTCGTAGC
TGGTCAGTCCCTTGAAGCCCACGAGCGGCACGCGCGAGCATCCTGTCGTGAACTGCAACAAACGCCGGCGGTACTCGTTCGGCATTTCGCGCACGATCTC
CCAGAACCACAATAGCACCGGAGAGCGCGCGACGCTCTCGGCCACCGACGTGTTCTTCTCCCAGTCGTTCACGTCGATCTCGGGTGAGCCACACATAAGA
TAATCCAGCTCCTCGTAGTCAAACAGCAGTAGCAGCTGCTGCGGGATCACCTCGTAGATGCCCTTGAGGAACACGTACAGTTGATCAGCAACGCTTCGAA
GCAGCAAATGCTCGAATTTGCGCTCCAGATACTCGTGCTTGTTGGCGTCAGTCACTTCGATGTTGCGTCCATTTGGAATGAGGTCGACCGTCATGGTGCG
ATCGCCAACGGGCTCCAGTACGCTAAAGTCCAAGTCCAGCGCCTCCACGCCGTCGTTCTCCAGCATCCAAGACATGCTCTTGAACACGTCCGGGTCAAAA
TACTTTAGGTCGTCCAAGCACAACGGCGTGCCGAGAATGAGCTTCAACAGCGGAACGCACAAATGGAAATTCAACACCGTGCCCTCCAGCAGAGCGCGGC
CTAGAAGCCGCCCTGCCGCGTAATAGTAGATAAGATGTTCCTCGCCATTTTCGTAGCGGGAATTCGAATTCAGGAAGAAGGCTCGATCTTCCCCATTGGT
GGCCTTGAAGAGCCCCGCCCTCGGGTCTGTGAGCATCTCAGTAAGCATCATGAACCACTCGCGATGCAGTCCACCAGCGTCCACGCCGCTCTCTTCGAGG
AAGTTGATGCGCATAGCGGATCGAATATACTTCTCCTCTATGCATCCCAAGTGCTCCATGGATTCCTCAAACATGTAGTCTCGGTGAATGGAGAGCTTGA
GGAACTCCA