Description :
From Genome Similarity Track
Location :
contig_37:343304- 344313
Transcript NameFunction/comments
g9377.t1XP_008890725.1 hypothetical protein PPTG_00901 [Phytophthora parasitica INRA-310

Sequence
1009 bases(100 bases per row)
GGCAGGTCCAGCCGGTTGAAACACGCGTAGCTGCGCACGAACTCGTCAGGCGCGCCGACGATACCCCGGATCGTGAACAGACACACCTTCCCGTCGTAGC
TGGTCAGTCCCTTGAAGCCCACGAGCGGCACGCGCGAGCATCCCGTCGTGAACTGCAACAAACGCCGGCGGTACTCGTTCGGCATTTCGCGCACGATCTC
CCAGAACCACAATAGCACCGGAGAGCGCGCGACGCTCTCGGCCACCGACGTGTTCTTCTCCCAGTCGTTCACGTCGATCTCGGGTGAGCCACACATAAGA
TAATCCAGCTCCTCGTAGTCAAACAGCAGTAGCAGCTGCTGCGGGATCACCTCGTAGATGCCCTTGAGGAACACGTACAGTTGATCAGCAACGCTTCGAA
GCAGCAAATGCTCGAATTTGCGCTCCAGATACTCGTGCTTGTTGGCGTCAGTCACTTCGATGTTGCGTCCATTTGGAATGAGGTCGACCGTCATGGTGCG
ATCGCCAACGGGCTCTAGTACGCTAAAGTCCAAGTCCAGCGCCTCCACGCCGTCGTTCTCCAGCATCCAAGACATGCTCTTGAACACGTCCGGGTCAAAA
TACTTTAGGTCGTCCAAGCACAACGGCGTGCCGAGAATGAGCTTCAACAGCGGAACGCACAAATGGAAATTCAACACCGTGCCCTCCAGCAGAGCGCGGC
CTAGAAGCCGCCCTGCCGCGTAATAGTAGATAAGATGTTCCTCGCCATTTTCGTAGCGGGAATTCGAATTCAGGAAGAAGGCTCGATCTTCCCCATTGGT
GGCCTTGAAGAGCCCCGCCCTCGGGTCTGTGAGCATCTCAGTAAGCATCATGAACCACTCGCGATGCAGTCCACCAGCGTCCACGCCGCTCTCTTCGAGG
AAGTTGATGCGCATAGCGGATCGAATATACTTCTCCTCTATGCATCCCAAGTGCTCCATGGATTCCTCAAACATGTAGTCTCGGTGAATGGAGAGCTTGA
GGAACTCCA