Description :
From Genome Similarity Track
Location :
Scaffold_66:3433- 7188
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_66-fgenesh-gene-0.7DEAD/DEAH box RNA helicase

Sequence
3755 bases(100 bases per row)
AaTCCAAATGACTAGTTGCATCATTCTCAGTCTTGGTAGATCCATTCGTTCTTACGCTTCTGTTTCTTCGCCTTTTTCTCGGCAGCCACTTTCCTCCAGT
CAATGTTCCTGCGCTTCAAGTCTTCTTTAATGCGCTTCGCCTCCTCTCGGTTCTTCTCcAGTTGCTGAACATCGAAAAAGTGGGACATCTGACGCCCTTC
ACGATCCGTCGCGACACCCATCGCCTGCCAATATTCATCTCCGCCCAGCTTCTCGAACTTGCCAGTCACACGGTTGAACTTTGCTGTAGCCGCGTAGTGC
TGACCAGACACCATCatCTGTGGGTTTGTGCTCGTAGTAGGCTCAGGAGTCACGGGAGGGACCCAGTCAGCCAGCTATCAAAATCACCACCGGGTCAAGA
GTTATCCCATGCAGATTTAGATAGCTGCATCACTTACcGCTGATACAACCGGCGCATCTGGCTTCTGCCATTGGGTGACGCCcGTCACAaCATTATGGTA
gTAGAAGCGTTGGGACTGAGGATCAAGATGCTGCTGCCACTCGgCACGCGCTCTCTCTTTGAGACTCTGTTCGATgTCCTCGGGTGCGTCGACCTCgaCG
TCTTCTCCAGCTCCTGCTCCGTTACTATCGATCTTACTCAACAGTGCGTTTAATCGGCTCAAGTTGCCCTGTGGATCCAATGCTTGTTGGGTGACCCGGG
CAAGTCGTTCGGCCCGTGAGCGATGCAAGTACTCGAGGTAATCGGCCGAGATTtTTGCAGTCGGATTGGCCTCGGTAAAGTGCTCAGGCTCCTCCCATTG
AGTtCTGTTGGAGATCGTATCATGGTAGTACGCCTTGCCTGTGGTTTTGTCCATGTGCTTCACCCAGTTCGTCGTCGTCGGTGACTCCTTTGTCGTCGAT
TCAGCGAGGGACTTCTTCTCCTTGTCTGGATCTTCCTGGTTAGGCTCTTGTGGCGATTCATCCACGTTCTCATCGGCTTCACTGGTCGTCGTGGCTACCG
GTTGTTCTTCCTGCTGCtCCTGCTCTTGTCCTTGGTCCTCCGGTTCATCCGCCTCCTCCTCCTCCTCATCGTCGTCGTCTTACCACATTACTCAAATTCA
GCTCTTCGGCTCTTTCCCATATCGAAAaaaTCAAGCAAAGCGCACCTGATGCATCCTGGATCTCGCCCTCTGGCTCGTCCCACTGCGTcACCTCATTGGC
TTCGTCGTAGTAGTACGGCTTGCCGCTCTTCTCATCCACGAAGCGGCGCCATCTCGGAGGTTTGCTCGGCTCTTGCTCCTCGTCTCGTGGCGCGTCTTCC
TCCACCGCGCCTTCCTTCTCGACGAATCCTTCcGGCTCCTCCCACGACGACTCGCCCGTGCGCGTGTTGTAGTAGTACGGCGCGCCCGTGGCGTCGTCCA
CATACTTCTCCCACTCGCGCTtcTGTACCTCGGCCATTTTCGCAACCATTGACAAACACTGCCAGTATCCCGCAACATAACTCGAATtTAGGCAACATAA
TCCTCCTACAGGTAACATAAGGGCAACatGTCCCGTCTGTGACGTGCGCTCGCTTACGAGACTCTCAACTGATATGCCTGAAGCACTTGGGCTCGGTAGC
ACGCCGCGGAGTGCAGCAGGTAGAACTCCCACGTACGGCGGAACGACTCGGGTAGTGACTGACCTACGACTCGGGGTTCAGCTTCAATGCTGTCTCGATG
GGAAGATGTGGTCGAGTGGCGTCGACTCGAAGTCGCACTGGACGATCGACGTCGTAGATCGCTCACCTCCACCCAGCGAGCACGGAAGCGGCGATGCCAC
TCCACAAAGGTGCGCTCGTAGTGCTCCGTGTAGCCCGCGATTTCGTGCACAGCAAAGCCGCTGAGACTGAGCAAATTTCGCACGCGGTGCAGGGTCACGG
GATGAACTGAGAACGCACCGTTGACGTAGTGGTTGTTCCACACGTGAGTCGTCGACCGAGCTGCTCCGCATCCGACAAAGTCGAACAGCGTTTGCCCTCG
AGAGGCTTGTATCCGCTTGATAGTGCGAAaGAATCGAGGCAGATCAATCGGGTTTAACGCCTCCACGATGTTACTTGCGACAATACACTCGAAACGCGAT
GCGCTCATCGAGCTGAGCACaGTAAGCAACTGGAAAacaCAAGCACAGAAATTAGAATTGCCTATGgTGCTTTCGTGTATACACATTCGCACCTTATCTG
GGGTATCAGCAACGATAAACTCGATACGATCGAGTACCCcACGCTCTTCAGCGAAaTGCGTAGCATGTACTCTCTCCGACGCGGCTGTCAGCACACTGAC
AATGTGAACATCGGGATGGCGCTCcgCTAGATACACAGCGACACCACTCATGGACCCGAGACAAATaTCCAGAATGCGCTCTTGGCCCTACAAAAGCACT
CTCAGCTtcGACACAATGGCAACGGGTACAACGCATTACCTGCAAACTCAGCTTCTCCATGATACTCTCCATCTTGTTGCGCTGAGCGTCTTCAAGTGTC
CGTGCATCGTTGATCCATATGCCGAAACCTTGGTGGATGTAAGGATCCATGTACTGGCGTCGAAAGCTCGGTGACAAATCGAATTGCTCAGCTGctGGTC
CCACCACTAAGCCCAGCGAACTAGGCGGGTAGTTGAATATTCGAGCAGCcAGTGCTACAAGGCGAGCTGACCAAGAACGGTACATCTCTTGACGTGCTTC
CATCGGAAGCGTCATCAACGCGGTCACTACTTCATCGAGAGATCTCCCAGATGCAGCATCCCATAAACCACCAATGTAGGTTTCCCCAATTGCTACTAGA
CCATCACGCATCCAGTCCAACCAAaTGGCGTCGTCGCGCACGACAAAGTCCTAAATCTCACAAGCACGATATCAGCACGATGAGTGgATGTTGTTTTTtC
GCTGGCTGACTCACCGTCGCGGTGTCGAGTCCTCCTCCTGCTAGCAGACGaGACATGATTTCTTTTGCGTTGCTTCGAAGCTTTTtCAGTGAGTATGTCC
GAATCATATGCAAAGCCACTAGAAGAACACCTCCAAAGGCAGTCGCTGTGTAAACCCAGAACGACCGCTACAGTCATCGAACGCGTGAGTCGAAGATACA
GTCACACCAGTGGAGCACCAGTCACTATACCTGGTGAGCCAGCACACAGAAAAGTGGTACACAGAGATTTAGCAGAAGCTCAATGCGGTATGCAGCATTC
CAAAAGTGCTCCGGGCGCGGTGGGGAGAATCTgAaGACGTCGTCACCTTTGGGGAACACTCCGCCTCCAATGACAAAGTGGACCCACAAACGCGAAGCTC
TGGCCaCGACGTGAGCAtAGTATGCATGGCCCGGATCAACACCGCCAGTGTACGTACATTAGCGCAGGGATACTCATCCAGACACGAACGAGGGGAAGAA
AACACGAGATAAGGATCATTGGTAGGAGGAGATGCACGAGGAAATCTCCGATGCGGGCGGCAAAGCCGACAACGGGCGAATTCGCCCACAGCCCTAGCCA
GCCGCGAAGCCCTGCCGTGAACGCGCTTCGGTCATAGACGCGGAGAGCGTACCACCCGACCATGATCGTGATCCCCATCGATGTGGCGATGGCTCTGGCA
GCAGGCGACGCTGAAAGCAGCGCGAACGCCGTGAACGTGAGCCAGCAAAGCGTGTACATCATGCGGAAGCCCAGTAGAGGCGGCACAACGACCACAGCGA
ACAGTAGCGCAACCGCGAACGCTGCGTCCACGACGTGTTCATCGGCGACGGCATC