Description :
From Genome Similarity Track
Location :
Scaffold_166:3433- 4620
Sequence
1187 bases(100 bases per row)
CGCGATTGAACAACTCGACGTGGACACCGCGTACCTGAACGCTGAACTGGCCGAGGACGTGTACATTGAGATACCGGAGGGACTGGGCATCGACGGTGAC
TATGTACTGAAGCTGAACAAGGCGCTGTATGGTTTGAAGCAGGCCGGCAATGCATGGTACAAGACCATACACCGTGTGCTACTCGAGATTGGGTTTACCC
CGTGTGGAGGGGTCGCGTGCATCTATGTGAAGCAAGTTGGTGACGACCTCGTATACCTCTGTATCTACGTCGACGATATTGTTGTGGCTGCCCGAACGAC
CGAGCTTGTCAACGACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGTATGGAGATCACCTACGACCGCGACGTGCGCACTATGACCATTACACAGACCCAGTATAT
CAAAAGCACGGCAGAGCGCTTCAACCAGCAACACGCACGCGAGACCATGAACCCACTCGACCAGAGCCTAAAGCTGTCGAAGGCCGACGGACCGACAACT
GATGCCGAGAAGAAGGAGATGAGTAAGAAGCCGTATCGCTCGTTGATTGGAAGCTTGCAATACATTGCCCAGTGCACACGACCTGACGTAGCCTACGCGG
TAACACACCTGAGCCGGTACATGGAGAATCCCGGTGTGAAACATTGGAACGCCCCGATCAAGATCCTACGCTACTTGCANNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNACCCATTGTGTACAAGTCCAAGTATCAATGCACGGTAGCGTTGAGCTCGGCCGAGGCCGAGTACCTAGCGCTGAGCTTGTGCGGG
CAAGAGGTCATTTGGGTGCGAACCATGATGGAGGAACTGGGGTACAAGCAGTCACGTGCGACCCAGATCTGGGAAGATAACCAAGGCGCTATTGCACTCG
CACACAACACGGGATACAATGCACGGACCAAGCATGTCGACATCCGCCACCATTTCATTCGCGAGAAAGTGATCGACGGTGAGATCA