Description :
From Genome Similarity Track
Location :
Scaffold_1289:3432- 7550
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1289-snap-gene-0.3E3 ubiquitin-protein ligase UPL6

Sequence
4118 bases(100 bases per row)
CTAGGACATTTCAAAGCCCGCGCCAGAGGAGATCGAGATCAGCAGCTTGGCGCGCAGCACTTTGAACGACGAGTACGTCGGCAGCTTAAGCGTGTTGAAG
CACGTAGAGGAGCTCGGCAGCAGCTCGTCGTCGTTTCGGATCGAGATCTTCTGCACACAGAACACTGGCGTCAAGCTGCTAAAGCCCAGCGACGGCGCGC
GTTGACAGCTCGTCGTGAACCGCAGAAACGCCGCTTGCTCTGACGGCGTGAAGCTTGCGAGCGCCTGCCAGAACCACATCACGCGCTTGTCCATGGCAAA
GTAGCCACCAGCGTACTTGGCGTTCGCCTTGAGGTCCTCAACGTCGATCTGGCCGCTCTTGCCCGAGATGAGCACCTGCAGCTCGGGCTCGTTGAACATT
TGCAGCCAGCGCACGTCAATGATGTCGGTGAGTCCGGCGCGGAACGCCGCGCATTGCGACCGGATCTGCGTGTTGAGGTAATAGTTGGCCACCAAGTGGA
TGTACCGTGTCTTGTTCTGGCTCGTGACCGCGATCTCTCCACCACCTGCATTGCACGGATAATTAGCACATTGCACTCAATACGTGTCCACTTCGCAGGG
CTTCTACTCAGGCTGAGGGTTCGTACGTACCTGGAATCAGGTCAATCTCTTTCTGGTCGCCAAATACGTCTTGTACGATCGTGTGCGTCAGTCCCAGATC
CTCGACGTCACCTTCGTAGGACTTGAGGAACATGAGGTTCTTCAAGATACAATGCACAACAACATGCAACACTTGTTAGAGATCACGATGACGATGTGAT
GAAGCTGAACGCTGGCAACCAACCTTGTAGATCTCCGGGTCGAGCGATGGCAGGTCGTTCACGTAGTTGAACGAGTGGAGCAGCTTGGAGAGGAAGAAGT
GCGCGAATTTTGGCTCAACGACAATGCCCTCGTAGAGCGCTTTGCCCAGGATACGTCCGACGAACTGGAAGAGCGTCAGGTGGTCGCTCTCACGCGTGAA
ATGCGTTGACGCGGAGAACGGATTCGGGTACAGCAGCTGGTCGCCCGTGGTGAGGAAGAGACCGTACTGCAGATCAAACGCCAGATTCGACAGGTCGAGC
CAGAACTCCTTGAAGAGACCGCCGGCGTCAATGCCCACTTCTTCGCGGCCAGCAGCGTTCACAAACACGACATTGATGCGTTTCTTGAGATTCGACTGGA
TTACATTGAGCTTCTTGAGTCCGTCCTCCAAGATCATGCCGCGACGAATGCGAATGCGGTAGATCGAGCTGCCGTCTCCCTGGTGCGACTGCTTGTCCGC
TTTGATGATGCGCTGGAAAAGCTTGACGCGGTCTGGGAACGGCACTAAGTACGGCATGGACGCGATCAGTTTGTTAGCCCTCGGCGTGCCCACAAGCACT
TCCTCAATCAACTGGTTGCTGTCAAGCTCCTGGATGACCCTGTGAGTAACAACAAGTTAATATAGCCAACATCGCCCGGACAGTAGGTAGTCCACCAGCA
AGTCGACGTACCAGCTTGTGACGTTGCAGAATGGCTGTCGGGAGCACCGGTTGTACAGATCGCGCATCAAGGTGGTCGCTCCGTCAACAACAAACATGCC
AAACGCAACATCCGGTGATGATTCGGGCGAGCCCGAGGCAGGAGCAGCAAGGTTGCCGTGCACCCAGTAGGCTGCATGCAGCGCCCGCTTGAGGTTCAAC
ACGATTCTTTCCACCTGGAAGAGTGGGAGCGGGAACTCGTCCTCGTACATCTATTGAATGGTACAGAATGAATACAAGTATGTTAGTACGAGCGCATCAC
AAAAGAAATGAGAATACAGACAAGCGCACCTCTTCATCATCCATCACCACGAGAAGATGGTTGTACGCCAGGCAGAAGAGCGCTAGCGTGGACGCGTACG
AGTCGCTGGGGTTGACTCGAACCAGGTCCACGTTCTGCATACCAATGAACAATGTGAGAGTCCATAGATCACGTCAAGCAAGAATTGTATCAATCTTCCC
TCACCTTTGCAAAATCTTCGAAATTGCGCGTTTCTTGGAGGACACACCACAGGAAGTGGACGAGTGACGTCCGTTTCTCGCTATCGCCTTCATGGCTCTG
GCACTGGTAGAATGCAAGCGTGTTGAGCAGTTTCATCCCGTGGACTTGGATTTTGTTGTTCTGACGACCCCACCGAAACAAGAAAGTCGCCCATAGGCTC
GAAAAGGCCTTGAGATTCTCCAGAGCAAATGGCTTGCCCAGCTTCACTTTCTCCAATCTCTCGGCTGTCTTCGTCCTTGGAGGCTTCGCGTCCGAGCGCT
TCCCTGAAGCTGCCAGATGACGCGCCGAATTCGATGTGTTTGGCAGATGAGACGCTTCTTTAGTATCTTCTTCAAACGCGTTTCGCGCTTTCCTTCGCAA
GCCAGCCTTCTCCAGAAGCCCTCGTGCCCAACCAGCTTTTCCAATCGATTTGACTTTCTTCCAGGTCGTCAAAAGGGAGCTCGCAAGCAGTGACTCGGAT
GCGATGTCACCAAATCCGTATTGCTCCTGCGCCAGTCATAACAAAGATTAGTAATTTTGTCACACCGTGCACAATAGAACGATATGTGCATACCGCGAGA
CTGAGAGCCGTGGGGAACATCGGAATGGGGCGAGCGGTGGAGAGCGGGTACCGCAGACTCGATGGGTTGAACCACAAGAGGTTGTTCGCAATCGTGCGCA
CGTATCGATCTCGAATCAGGATCTGCAGCTGGTCGTTCAATGCTTCTGGGAACACGACGGGCACGGAGTGCGACTCGGAGACTTTAGTCCACGAGACTGC
CACTCCGTTGGCAGCGAACGTCTCGGGCGGCACGATCTGCAGCAGCTTGGTCAGCATCTGGACTTCCTGGAGCACCAGCTCTGGTGTTTTTCCCTTGACT
CTAGGAAAATTTTCCAAAGCCTCGTCAGTCCTCTGCCAATATATAGTCGTAAGCTATTGTGCCTAAAAATGAATGCTCACCTCTCAGAGATCCAGAGGAT
GTTGCCAAGCAGCCACGTGGAAGACGAGATCCCGACGGCTGGTGCGTCTGGGAGCTCAGTGAACAGCTGAGGTCTTGTGTTGGCGACCACCACGAGCGCT
TCCCACACAGGACGCTCGCCAAGCTGCAGCAAATGACTTGCGGCGACGACCTCGTACAGCAATGGGATTGATAGAACCTGCACATGCCGTAGAGTAAATC
AGTATCACCTCTCATATCCAATGACACTCCTCGCTTTGAAACGTACCTCTTGAACAAACGAGCCTAGGAAGACACTCGACTCGCCACCCGTGGACGTCCG
TAGGAAGCGCACAAGCAGGTCCATCATGTCGTTGCACCGCGCTAATTTTGCCGCTGGGATGCCAGAGGCCGACCCCAACTGGTGGTGCTTGCCACGGGCG
CCAACAAACACCATTCGAGCAATCTGCACGAGCGAGTGCTTCTCCATATCACTGTAGAGCAGGCTCTTGCAAAATGATGTCGTTGATTGGTCCATTGTCG
CCATTTGTCTCCCCGTTGATAGATACTCGCGTAGCTCACTGGACACATCTGCAAGCTCGTACACGACTGTAAGCAGCACTGGCGAGGAAGAGGGCGCCTG
GACGCAGAGGTCGAGCAGGCACTTGAGCATCCAGAGCTTCCGTGGCGACAGATCGCTATTGAGCGCATCAGCATTCGCACTCAGTGCGTCCTTGAAGAGC
GTCGCCAGCTGCACGAGACGGTCCGCGTCGAGCGCCACCCCACGATAGGCAAACAGTAACTTGCGCAGCAGCTACAGCACAGTAACAACAACACAGTCAA
GCCAGCACTGCCACAAAAACACTACACACCACTATACGCACGTCAAAGAGCGCGTCGAAGGGCAGCGGCATGTCAGGCAGCTGCAGGATGAGCTTGAGCT
TGGCAACGTCGCCCATCTTGTGGTCCAAGTCCGCCCGGAGTGCGCTCTGGCAGCGCTTCGCCGCCGCGCGGCCGCGCAAAAACGCCTGCAGTCTGCGCGC
GACACCATCTTTTTCCTTGAGCTGCGAGCGCGCGGCGCGCTGCTCCTTCGCCAGCTGCAGCACGCGCGCGCGCTCGTCGCCGCCACCGCGCCGCAGGTCC
TTATCACGGAGGAACATG