Description :
From Genome Similarity Track
Location :
Scaffold_58:343080- 347125
Sequence
4045 bases(100 bases per row)
AGAGGGAAAGAACTCTTTCTGCAGTTCACACAAGGCGCACTGAACAAAACAATGTCTCGTCAGCAGAAGGATTTCTGCTGGCTCGAGAAGCAGTGGTCCG
TTTCGTGCTGGACTCCATCGCTCACGCGGTGAACCGGCAGAAACGGAACGCTGACAAGAATGGAAGAGCAAATGTTCTTTCGTTTATTGAAGGCGATTTA
GTCCTACTATCTACGGCAAATCTACCTTGACACTTAGTGACCAACGTGGGCAGCAGTAAACTACTGCCCAAGTACATCGGCTCCTTTCGTGTGCTGCGCC
GAAAAGGCAACACATACACGATCGAGCTGCCGCGTAGGATACGTACGCATCCTACGTTTTACGTGAGGCGTCTCCTCCCGTACTGTCAGTACGAGCCATC
TTCCGACGATGAAGATATCCCCCACGTTCAAGAATCTCCATCAGATTCTTGCGCTCGCGCTCCAGGCGATCAGTCTGGTCGCGTAGTGAAGAGACCTCTC
CATTCAACCGAGAGATCTCTTGGCGAGCTGTCGCCAGCTCGTCACCAAGGGAACGGACATCACGCTCAACCTGAAGCTGTTCAAGGGCGTAATCAGCACG
ATTATTCGCACCATCAGCTTCACGATCCTTGCGGTGTTTCCGCACAAGATCTGTCAGAGCGTAGCGTCTGTCCCTTTCGTGCCCCAAATCCTCGCGCAAC
TCAACGATTGCGCGATCCATCTCGTGTGGGTCGAGATGGTGAGTCGAGCGACTTGGAAGAGGTTTTTCCTCCTCCTCCACATCCTTTAGTGGACTCACAC
GGTGGTCAACGCTTCCTTGTGGAGCGTATCTTGAACCACCGTGACGATTCAGGATCAAGAACGAGTTATCTCGTCCAGTGGCGGGGGTATCCACCCTCGT
GGAATAGCTGGTAGCCCCGCTCCCAGCTAATGATGGATGTGCCCGGTCTCGTTGAGCAGTATGACGAGACGCACCCTTTTATGGTTGAGGCCATGGTCGA
AAGAACGCCCGGCGCGTTCGTAAAGGGATTGTAAAGTCTCAATCCCTTGGTACATCTCGGACGAGATGCGCGCCCTCCATTAAGGCTTATTGGGGAGGAA
GGCCTCGCTAGGGGCGCGAAAAGGGTTGTCAACACAACTCTGACAGTTCTCTCCCCACGAGAGGCAAGGTAAATCAGCCTCTCGAGATAATCGGTGCAAC
TTAAATTGAGCACCGGTTGGCGACTTCTGTTCAAAACTATTGCGAGCTGGAATAAGTTTGTCCAGCCAAACCTCGCGGCCAACATTTCGATGTTGCCGAC
AAAAGAGTTCCACGCCTGCACCAACGAACCTTCGTCTCGGTTGCGGTTGCCGTGGTAAGTACTCATGCTCAGTGCGATAGTATTTCGCACTGACATCAAG
ACCATGGAGTCTTGACGAATCAAAGAGTGGGATCCGACAACTCGCAGTGGTATAGCCATATCACTCTGTCAGATTGCGTAAAGAAGGCATCCATGGTTTG
TTTTCAGGAGCAAATCGTAACGCGTTTCGATCGTTCTTCTCTTGCGTAGTGCCGAAATGAGTACTGGCACTACGATCGCCGCAATAACTGGTATTGCTAC
GGCTGCGATGACACCGCGAAGAGTCATCGACATCATCATGACGACTAACGTCCTCATGTTTTGCACTCGCATCATACGAACGCGAGCGCGATTGATTCGA
TCCCCGCGACGAGTGCTCAGACTCGTCAGATGAACCGAACATTTCACGGCGCAAATCGTGACTGGCACGAGGTACAGCAGTCGTCGTTCCCGCACCCACG
GCTTTGGGGCCGGGCTTTGCGGGCGACTTCGAGTCGGACGGGGAGTCAGAATCGCCCGAATAGCGAACCTATAATTCGGGGTCGACGTCCATGGGACTAC
CACCCGCATCCGAAGCTGCGGATGAATAAGCTGCACGTGAATGTCCATGTGCACCTACAACATTGGGTGTTGCAGGCTGCTTATCTGCAGCAGCAGGCGA
CGAAACGCCTGCTGCCGAGGCTTGGGTAGCTTGGTAGCCGGCTGCACGCATCCGTGCAGCCGCTTCAGACGCAGCCTTTTGCTCGCGCAGCGCATGGACG
AACTCGTCATGTGCTGAAAAGTTGGAATGAGAAGGGAAAATACGAACAAGTGCTCCTTTTCTCCAGTGCGACAAGACGGTGGCCACTATGTCGCCAATTA
ATCAAATCACTCACTATGGTGACTGATGGTTAAGGGGGGGATGATGTAACGGGGTGCGCCCGTTACATAAAATTGATACGAATGTATCAATCTTTGAATA
TTATCTATTTAGATAATATTCAATTAACATCACTCGCGAAGAGGGGATGTTGGCGGAATATTACCCTCGGGTCACCCGGTAATATTCCGGGTTGCCCTAC
TTTTGGTCGATGTAGACACTACATCAGCCTAATTAACCACCGATCGCTGCTGGAAGCGCGCAATGGGTGGTGAGCGAGAAACTATCGCACAACAATTTTC
ATACAAATGTTAAGTGATTTACCAAGCAAACTTCTTTTGGCACGCGTCGATACATTTTGGATTCATCTAAATTGATATTTGCATCATTTCTCAAATTACA
ACATTCACGTTTTAGTGAAAAAGGTACAAAAATGAATGAAACAAAGGATAAGGTTTCACCGAACATAACCGACTATACCCGTTTCAGTGAAAATTATTTT
TTATCACTAACAATGTATTATACAGCTATATTTATTTTTGATCGAGCCTATCCTGGATCTACGCTAGCATCAGGACATTCATGTGCAACAGTGGTCTAAC
GGAGGTATGGTGGCACGATATTTGTCGTAAAAATTGTATTGTGTTGGCATGGGTGTGGTGTATGCGGTGTATTAATTAAAAAATGGGGTGTATTAAACGG
TTAGAGCCGCTTATGAGCCTAAATTTTTCGCTAATAAGCCTTCAACCCATACATTAAATAAGTAACTGGGTTTAAAAGCCTCCAACTTGTAAAATTGATT
CGTTGTACTTCTTAGAAATTTCATTCATAATTGCGAGCCCGAAGGGTGAAGCTATTAGTGAATGTGCGCAAGGTTGAACACCGAAATTTCAAATCATACT
TTACTGTGTGTGTGTCGGCAAATAACGCGGTTAGGTGTACCGTTCTCGTGCTAAATGCTATCTAGACTGTCCCCCCTCATAGTCGATTTATCATGATAGG
TGTCACTCTATGGCCAGGTCCATTTTGTGATGCTCGTACCTGATTGGCTTATAATCGATCAAAGGTGAATATGATCACATCAGCAAATGCTGGACTCTCA
TAAGCAAAGGCCGATCGCGTTGCCCAAGTATTCTGTACTGGGTCGGTACATACGTTAACATCATCATACTCCTTCTTCAGTGACTGCTGGTGTTGTATAG
TGTTTTGCAACTTGATTCATTTCTCCGAACTAGATTACTTGTATCAAAGGGCGAGCTCCAGAGCTCTCCCCCTATCTTATATACATTCGATACTGAGCCA
GTTATTTTCGCAACTCTGCATAAAGCAGCCACGTTATAGGAATTTCTCCCTAGCATGAGCCGGAGAGAATAATGCAATATCCTGGTTATTCTGCTATAGC
AGTCGTAAAATGTGCCAGAAGTAGGCCAGGGGGGGCTTTATACTGGCTGACATATTGCGTCTCTTGATCGCTTCAGCGACCGCACACACAGTCGCTGTGG
CGCGCAGGACTTAAAAAGAGTTTTGGATGACGGTGGCTCCTTCTGTCGCTTACATCTAGTTGATCTGCTACGCTTGAGATCATTACTAAAGACATCTGTT
AACAAAACAAGCCTACTGAAACTTATGCTGCATACGGCAGCAAACTACTGATATTACTTGAAATGTAGGCTCTCATAAGAGGACCACCCGACAAGCTCCG
AAGACAGCGCTTCGCACTTACTACAAACGTATTCAGGCCATTTTTAACATTGACGCGTAAATATACGATCTTAAAAACATGATACACATCTTTAATGATG
CTCACCCTCTAGTTGTGCTTCAGTGCTATGTCGAACCCATCTCCC