Description :
From Genome Similarity Track
Location :
Scaffold_14:343047- 346062
Transcript NameFunction/comments
Hyaar_Emoy2802647transcription initiation factor IIB, putative
Hyaar_Emoy2802648unkown protein
Hyaar_Emoy2802649PREDICTED: uncharacterized protein LOC101763240

Sequence
3015 bases(100 bases per row)
CGCCCAGATCCGGTACATTCTAGCTTCGCTTCTCTATCATTCATCGTGCAAGACCTGGAAGCAGATGACAAGAGCAACAGAATAAAGCACTATGCGTTGG
TCAGATACTGTGCACAAAGCAAGTGCCGAATGCTCCAACAATTTCTTTGATTGAGCTTACCATGCACGTGGGAGGTGCGGTCTTCGATAAATAGATACGA
ACTTGAGTGTATCGTAGCTCTCTCCTTCCTGCTGTTTCCTGACGAGATCTTGTTTCTTCGCCACCGGTTTCCACTCATACTGCCGTGATGCTTCTCTTGG
CATCACAACCAACAGTCGTCTACGTCATCACCACACCTTCAAAAAGCACCACGCGGCTCTTATTCAGCTCCTTGCACACTTTCTTCATGCTCTTCTCGCC
AATCATCGTGACATCACTAATCTCCTGGATCGACCGCTTCGAATTCGTGTACGCGGCCACGAGGTAAATCACTGAAGCTGCCACTGCAACAGGTGGTTGT
CCATTCGATAGTTCCAAATTATCTGCCTTCTTCGCCACTGCATGTGCAATCATCTGCGTCTTACTCGGCAGGCCAAGTCTCGAGCAGAAGCGCTGCACGT
ACTCTTCCGTTGTCGCCTGCTTGACCTCCAGATCTAGACGACGTTGCAAGCTCATAAACGACTTTCCGATCCGTCGTTTCGGAACGCCCGACGCGTCTTC
AAACTCCTTGAGCGAGCGCGCGTTGCCAGCTTTTCGACACGCGATAAACAGCACGGCAGCAACCATACTGTCCCGCTCGGGTCCTCGCATATTGACGCCC
TGTCTCTCCGCTTCAGCGTACACGTCCAACGCAATCTCGACAATCTTCTTAGGAAGCGACAGAAAGTCCGCAACTTCTTGGATCCGCGTCATGTTGCGCT
GCATCTTCCTCACTTTGGCACTATCCGACGAGATGTTCGGCCGCTTGTGTTTACCGCCAGGCTCAGCACCAGCACTTGAACTGCCACCAACTTTCTTTAT
GTCCACCAAATACGTGGACAGCGAGACACTGTCCAGCCGCGCGTCCGCGACGTCGCCCACCCTGGATTTCGCAGCCGAGTCACCACCCCGATCATCATTA
GCAAACGTCCGCCATTCCGGGGAATCATCTACAATGCGCTCACCGAGGATCATGCCGCAGCCGCGACACACGACGTCGCCCGCGCTAAAATCCGTCACTA
CGTCCGCGCTTCCGCACTCCCGGCAATGATCCGGCGCACACTCGCCGCCCATGAAAACGGTATATGTCGATCGAGAGGTTCTTTAAGTACGTATTGGGAC
TAAACGGGTCAACGATTGGCGTCCACTCGGTGCTCGAGACGGACGTTACAGACCGGCGCCGTTGTGGTCGTCGTCGTAAGCTCCTTTTTGTCGACCGGAT
TCCAGTTGAACAGCTTTTGGACGGTGGTCCACTCACGTAGGTCGTACCTAAGTGGGTACTTGTTTTTGTTTACGTACATTACCCAACTTACGTCATGAGG
CAGTTAATATTGAAATTATTTTGCGGGACAAAGTGTTGTGTATATTTTGGTTGATAGGATATGTAGCTACGGTAAAAATGGAAGCCTGCCCTTGTGCTCT
ATATGAAGCGCATGGTGACCATTGAAGCTATTAGACAGAATGGATGATGGTATACGATGCGTGTAGGTCAGTAGGCCGAACTGAGTGATCGTCACGTGTG
TTGTGTATTGGCGACACAGCATAATCCGTCCATGTTTATGTTCCGTACCCAATGCCAAGTCGCTCGTGCCACGTCTCTCCTTGTCCACGTTCTGCATCTT
CCTCACTTTCTAGAACTTGAACCCCTTCTTAGCAAGGTCCAGTTTAGCCGCTACCACATGTTCATCGAGTTCCTTGGATGCCTCGGGGAAGTCTTGTACT
GCCATGACTGACAACGTGATCACTGCCAGCGAGTACACGCCAAAAGACACGACCGCGAGCAAGGGCAGCGCTTTTACTACCGTCACCACATGTGGATCTA
GTGCATGATTGGACACGTATTGCAGCAGCGATAGCCATAGCGTGAGCAATGCTACACCTGCGGCGAGCCACTTCTGGTACTTGAGCATCGTCGTGCACGA
GGAAGAGTATCGAGCTTTGTGTGTACGTCACACCACACAATCCGCATGCTGCTGCTGATTCGTCAAAAACAAATCCTTGATTCAACATCGCTCATTGGCT
AAATATCGATCAAGGAATAGTCAAGTCCCGGATCATGCCCGCGCCTGTAGGTAACTCGAGCGACATGACGGCGGTCGTCGAAGACAAGACGCAGGGTTGA
CGCCGACCGGACCTGATGGATGAAGAACGACCGATTATGGCCAACTATCTGCTCCAGCATCGACAAGGACAGCCGCGTCTGCCGCGAGCAGTCATCGCTG
CAGCTGCCGACAAATTCCAAGTCCATCGGAATACGGTGTCCCGTATTTGGAGTTTCATGAAGCCGGTGCTGGACAGTGGCTCGTCTACTGACGTGGTGAT
GAGGCAGGTGCTTTCCAGGAATCGTGGCAATTGCGGACGCAAAAGAAAGGACTACACAGTTGCACTGGAACGAGTCAAGCAGCTGCCTTTGAACCAGCGC
TGCTCGCTGCGTGCTCTTTCGTCGGCTGTGGGGGTCCCACGTACCACATTGTTACGTCTTCTACAGAACGATAAGACCACGGACAAGACTGCAAGTGCTG
CTGGTCATCTAGAGATGAGTTTGGACGTAAAGCCGACAATCGCCAACATTATTAAACCGGCACTTTCAGATAAAAACAAGAGAGAGCGGGTGAACTTTTG
CTGCAGCAAGATGCAGCCAAATTGCGTGGTTGACATATGTACAACTTCGTGCATATCGATACCAAGGGTGCTTGCTACCCGGTACTTGTGATGCCCGGAA
CACAAAAAGCAAGAAGGAGAAAGTCATGTTCTTGATTGTTATCGCTCGACATGGGATGCCGGCCGGCAGCAACAGTTTGATGGCAAGCTCGGCGTCCGGC
CATTCATCGACGCTG