Description :
From Genome Similarity Track
Location :
contig_47:343002- 346893
Transcript NameFunction/comments
g7888.t1hypothetical protein
g7889.t1amino-acid acetyltransferase, putative

Sequence
3891 bases(100 bases per row)
CAGCACTAGGTGCCGAGGGGGCAGCGGGCTGGGTAAGTGGCTTAGCCCACGCGTTTCCAGTCGACTGGGAAGACTGTGGGGCCGGAGTGGGAACACCACC
GGGCGGCGGGCCCCACGCAGCGCCAGGGGAGGAGGCGGCGCCTGGCGACGGACTTGCGGGTTTTGAACGCGTGCGTGGCGACCACGCATGATGGCCTGGA
TCTTGGTAGCTGCCTGCGCATCTGTCAACGGTAGAGCCTCCGGGAAGGCCGTGCCGATCTTCGTGTCCTTGCCCCGGCCGAAGCTGAAGCACTTGATGTT
GCACAGGTACGGGCCGAGCTGTACGTTGTTGTTCTCCTGGCCGTTCAGGTAACACATGGTGTACAGGGCCATCTCGAACTCCGGGCTCACTCCGATCAAG
CTGCAAAATGCCACCACATAGTCGTTGTTAGTCACGTTGAATGTAGAAACCTTGATTGCAGTAGCCAAGTTTCACCTCGTGGACACGGGCTTTATCTCGT
CTTCCCACTGGAACTGGAACGTGATCAATTGCTCCTTGTTGTGGGGCTCCATAAACTTGCATCCGCGCTGCTTAGGGCGAATGTATCCCCTGTAGTCGAT
GCGGCCGTTGCGCTCCTCGTTGTACACCTGGAGCCAATTGTGGCAACCGCACACTTTGCCCTGCTCGGCGAACAAATCCATTAGCAACAAGACTAAATCC
ACTGATCAGATAAATCATCAATCTCACATTCTTCTCCTCGCCAACGAACACGTGCTCAAAGCCCGACGAGTCGTTGCGCACTTCACGGCGGTACAGCCCG
AACCAAATGAGCTCGAGCTTTTCTTGAAGTCCCCCATGTCGCCCGTGAACTTCTTGTTCTTGACCAGCCAACTGCAATTGACCGCATACAGTCAGAACTA
CATCTACACCCTCACCGCCATCACCGCCATACTCACGCGTGGGCATAGCGCATGGGCGCCGTCTCAAGCACAGCGTTCAGGAACGCGTTGTTCTCCGCCA
ACTCCTTGGGCGTCACGCGCTCCGTCACACCTGTCTGTGTATCACAAGGAGCCAATTACCACATAACTCCAGTCACGACTCCACTCTGTTCATTGCACTC
TCCAAACTGGTCGCACCTCGCGCTCGTAGTTGTCCAGCAGGTCGAAGAGCAGCTTGTACGTGCGGCGCTCGAAAACGCTCGGGTCCACGAACGTGAAGAG
CGGCTCGCGCGCCGCGTCACCGCGGGCGTAGGAGGTCTTGCCCTCCTGTAGGTTCACTTCGTAGTGCACGTTGGGCTCCAGACGGTTGGTGTCCAGCTCC
CAGAGCTTGTTGCACGCGGCCGAGAGGCTCTTGAGCTCGGCGACTGCAACGGCACAAGTCAGCATTATATAGGATTTCTCAGCCAATTCATTGCAATTCG
CCTACAGTCGGAGTGGCGTTGGCCATGATGCAGGGGCTAGCGACTATCAGCGGCTCGAGGCGATCGGGGAATGAATTGCATCCGTCCTGCAGCTGGATCG
AGCGCACCCACACGCTGTCGTCAGTTGCTGGAACGAATGATACATGTACACACGACTGCAACCAGCGAATCAGCGTCGATAAAACAGCTGCTGCCACAAG
ACAAGAAATATGCCAGCCAATCAGTGTCGTCACAACGACAGCTGTATATACTTGTGTACCCGCAAGATACTCGCCAAGATACCTTTTGCTTTCATGCCTT
GCTCGTTGCTGAGCCCAGTTTTCCTCGGCAGACTAAGAGCAGGTCTCAGACTCACGCACTCTTATCTGCAGCATCCAAATTGTTAATTGGCAAGCTGAGT
GTCTTGGTTGTTCCGCTCAACGCGAGCTATCTCACCGTGAAGCGGGACGTGCAGCTCAAACTCAAAACTCAAACACGGCATCGCAGATACCACGCCTCGA
TATAATCGGTAATCGGTGGCATGCAGGCGACAACACGGCCCTGGTTTGACTATCAAGCAATGCATGAGATTCGACCCCGCCTCCACAGTAACGCACTGAG
GATACACGTGGAGCGATGGAATTAGCCGCCGATGCGATCGCGCAGCGATTGACACGGGAGCGTCTAAGGCATCCCGTTTAACAAGCCGCTAGCGGCAATG
ACTTGTGCTTGCAGCAATATCTACAAGAAAGCCTTGTACATGCTCGACTTATAAGTGATGGCGCGCAGCGTTGCCTTGCAAAGCACGCCTGATGGCTCGA
GAAGCACTGAGGGCCACGAGCAAAATGCCGAGCGCACCAGAAACGGATGTCCGTACCTTTGTAACGAAGGCTTCAACACTCTCTTGTCCGATAACCTGGC
CTCCAGAATCTTCAGTTTGGCTGCATCCGAGCCAGACACACTCATCTTACATCATTTAACTTCGCTCTTTCATCATTTTCAGCATCGTTGGTGGTTTTGC
TAGGCCAGCCTCGATGATGTGCTTGGCCTTGCTTGGCGCCGCTCACCCGCCACTCTCGCACTCGCCTCGCCGCGCCCAGAGCTCCGTCGTCTCCTGCCTC
GCCCCAGCAGCTCCATGTGGCTCCGTCCCGGCGTCCTGCACACGCGCAGACTGCTCTTCTCGTCCGCGTGCGGTCGCTCGCGCTCGTCTCTGGGCAGTCT
GCGCGTCTTCACATCCGCCCGGGGGGCGTTGCAGGCTGCCGCAGCGCCGACTGCCCCGTCTCGGAGCCCCTGAGCGGCGGGTACCCCACGACCGCAGGTA
TGAAGCCGCCCGTGGACGACCAGCACGCCGTCATCGCCGACTTCATGCCCATCGTGCCGCCCGAGTGTCTGCGCGTGCAGCAGGCCGAGCAGACGGCGCG
TGGCGCCACCGTGGGCCCGTCCTCCTTCACGTCCATGTTCCGCGACATGTCGCCCTACATCAACTTCCACCGGGGCACGACCATGGTCATCCACCTGCCC
GGCCAACTGGTCGAGTCCAACCTCTTCGGCGCCGTGATGCACGACATCGCGCTGCTCAACACCTTTGGCATCAAGTTGGTGCTGGTGGCGGGCTCGCGGC
CGCAGCTGAACAGGCAGTTGTCGCTTCGCAAGCTTTCGCAGAGATTCGACTGCGGCATGCGCATTACGGGACCCATGGAGCTTCAGTGTGCCATGGACGC
AGCCGGCTCCGTGCGCTTCCAGATCGAGAGCTACTTGGGACGAGGAATTGTCAACTCGCCCGGACGAGCGAGGACGATCAATATTTCTTCCGGGAACTTC
ATCACTGCGCAGCCTGTTGGCGTTCGAGGAGGTGTCGACTTCAAGAACACAGGAGAGATGCGACGACTGAACGTCGATAAGGTGCGCACTGCACTGGATG
GCGGAGACATTGTGCTCATCTCCAGCATCGGCTACAGTGCCAGTGGTGAGGTTTTCAACTGCCTCTCAGAGCAGGTGGCGAGCAAGTGTGCCATCCAGCT
CGAAAGTGCCAAGCTTATCTTCATGCATAACGGCGAGGAGCTCATCGACTCGCGATCCAACTCCATGGTGCAGACTCTTGTGATTGAACAAGCGCAGCAG
TATGTCGAGTTGGCGCGCCAGAACACGGACATTAGCGGCGATTTCCTGCTGTACTTAAAGGAGTCTATCAAGGCCTGTGTGAACGGAGTCAAGCGCTCAC
ATCTTGTCAGCCGACACGTGGACGGCGGCTTGCTGCAGGAGCTCTTCACCCGCGACGGCGAAGGTCTTATGATTACAAAGCACATGTACGAAGGCATTCG
GATGGCCTCTACCAACGACATTGTGAGCGTCATGCGCCTCATCCAGCCTTTGCTGGACGACGACGTGCTGGTGTCGCGTGATCAGGAGCAGATTGAGAGC
AACGTGGACACGTTCACGGTTGTGGAGCGCGACGGTGCGATCATCGCTTGCTGCACACTGCAGCCGTACGAGAACAACTTCGCCGAGATGG