Description :
From Genome Similarity Track
Location :
Scaffold_176:3430- 24751
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_176-snap-gene-0.8Myosin
Pytul_var.sporangiiferummaker-pug3_contig_176-snap-gene-0.67 transmebrane protein Gpr8
Pytul_var.sporangiiferummaker-pug3_contig_176-snap-gene-0.9Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_176-snap-gene-0.7Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_176-snap-gene-0.11Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_176-snap-gene-0.12Polymorphic outer membrane protein
Pytul_var.sporangiiferummaker-pug3_contig_176-snap-gene-0.13Fibronectin type III domain-containing protein 3B

Sequence
21321 bases(100 bases per row)
CCAAATGTTGGTGACTCTGGAGGCGGTGAAGCTGGCGACATCGGAGGCGTTCCTTCGTGCGCCGGGGGGCTCGCTTGCTTGGTCGATTTCTTCTTCCCGA
AGAAGCCACCTTTCATGAACGCCGTTAATTTGTTGCTGCTGTTTTTCTTCTGAGGCGATACTGCTCCGTGGGAGCTGCCGGATGACGTCTGGCTTTCCGA
ATCTGATAGTGGGTTATCGCCATCCGACTCGTACGCATCACCATATGTAATTCCGCCGAATTTGTCATACAAAATCGAGAGCGTGGCCACAACTGCGACA
AAATCGCTACCGTCGATCAAATCATCTGGCTGGAAAATGTCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNCCACAAACAGTTTCACGTTCGCTCGCGAATGGAACGCCGTGTTGAGTTTGTTGACCTTGATGTTGGCGACCGGATCGATCGCGTTCGCGAGCATGCA
CAGCATCTGGCCGTCCTTGAGCATCAGTGAGAGATGCTCGCCATCGCTCGCCTGCTCGGTCACCTGGCAGATCCAGTCCTGTAACTCCTCGGCGCGCCGC
ACCATTCTGGTCGAATCAGCTCTGTCTACCACTTGCTCGCTGTCTTTCTCCTCGTTCTCTCTCGCCACTTTACGTCAATGCTAACGACGAGACGTCGACA
GTCTCAAACACACTGCTTGTCAACGCGCGCGCCTAAGAAAACGAGGGTGAACTCACCGCCACGCCTCACTTGTCGCTCTTTGTGTTTCCGCTTGCAACAA
GAGACGAAGGGGGTCGGAATGAAACCCACACTCACCTGGGTACGCTTGGGATGCCGCAAAGTTTCTTCTTTCCTCACTCACTCGCGTTCCTCCGATGGCA
GAAGCAGTCAGTTCCGCGCGCGTATGTCGCGGAGTTGGTTTCGCTTTTCAGACGCTCACACAGTTGCGGGCCTATGTACGAGCGGGAACTGACAACCGTC
TCCTTCCCTGTCCCTCCTCCCGCGTCCACTCCTCCGTCCACTGCAGTCCACTATCACAACTCAACGACAGCGTGCCAAAACCCCTGCTCCTAACCTACAC
CCACTCCAATTGCTGTCTCTTCGGACGCAACAGCTGTTCAGGCTGGGTATTGCTTTTGTCCAATAGTATTGGACAAACAATTCACTGGCAGGCCACCTTA
TCTATTCCCCTTCCCNNNNNNNNNNNNNNNNNNNGCCCCTGCGCCGGCTTTTCCTTGACACCTACCCCTTCGGTTTTGCTCGCTGGCGNNNNNNNNNNTC
AAAAGGGTGCGCCAATTGGTTGATGCTTGGGTTGTTCCGTCGTCTCTCTCACTGACTTTTTTCTTTTGGTTGGCTCGAATTCGAACACACTGCTGAACCC
ATACTGAAACCAAGTCAAACACCATCCTTGTCCCGTTTTGTCAACGCCACATGGAGCAAATGAAGCCACTTTGATGAAGATTCAGACACACACACACAAC
CGACTGGCGATTCCAACCAAATCCATACACGAAGACGAGAACTGACTGTGTGTGTGTGCTCGCGCTCAGCATTCCACGAATACCAATTGACTTGACGCAA
ATGGATCTAGGAAACGATACTCGTATACAGCGCCTTTACCTGCACGTGTGTTTCTGGGTGTTTGTTATGATCCGAGAGAATCCATTTTATATGAACTGCC
CCTCGCTCGCACCAGTGTACGTGCCCAGCATAACGCAACAGCACAGTATTGCAGTTGAGAAACGAAGGAAGAAATTTTCCTCCTGTATTGAATGGCGCCT
CAAATGGGATTGGTATCAAGGTATCACTCGATACCTACTGTCTCATCTGACGGTAGTCGGACCGAACAACCTTGCGTGATGCGAATCTAACCGAGACGAT
ACTGTGCGCTTTAGAGAATACTGACAACCATACCGGTAGGAGTACGGTACAGAATACCGTATACCGTTGTCAGCAGTTTTTCAACTCATTTTCTTAAAAC
TGTTTGACGCAGTACAGTACAGTACTACATGACACCTTTTTGCTGTCGTAAAGTGTCTGCCACGGTACTACGCTACCTGTTCTTTTTCACTTCAATCAGC
TGATGTTGTTGCTTATTGGAAGCGGAAAAGAAAAATGGAAAGATCCAAAAATGCGCACGAGGCTCCTCCTCCTCTCAGGCTCTCAGGCTCTCAGGCGGCG
GCTGACAGCCTATGGCAGAGCCACTCTCCGCTTCTCCAAGCACCAGAACAGAGAGATCCTCGAACTCCGCGCATCGCGACCCTCTAATCCGCGACGATGG
CGATGGAAGCTGTTGGGAAAGCGCGCGCTGCCATGCTGCTGCTGATGATGACTCTGCTTGCTGCCGCTGTTGACATCCCCGTGGTACATGCGAGCGTGTA
CGCAGGCTTCACTGTCGGNNNNNNNNNNNNNNNNNNNNNNNNNNTTGAGTATATTGGCAAGTTCTGCTTCACGTGGACGCCGACGCTTGAAGAGCTCGCT
GGGGTATGCGCGTGTGCATGTGCCTATGTACGCATCGCCGCTGTATGAGTGCCTGTTGCATTGCCTCATTCGAATGTGTATTTGTTTGCTGTTGCAGCGC
ATTACTGGCGAGATCCAGACGGACGTGGTGGACCTGCAGCTCGCGATCTATGACGACGAGCAGCTCTTTTGGGAGTACATTATGACGGACGACGACTGCG
ATTGCAACTGCAAAGTGTCGCGCGCGCACACCAAGTTTGTGTACAATGTTACACAGACAACCGACCTGTCGATCCCGTTTTTGTTCAGCTTTGACATCCA
CGAGCACCTGCGTCCGCGCTTCTGGTACGTCGCATTGGCACGCTGCGTGCCTGGCGGAGACGAGTACGAGCCGTCGTTCACGCAGATCACGGAGGCCAAC
TTCCGTAAGTACTACTTCACATCGTGGTACCGCATCCACATGACGCAGGCGAACGGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNGATCATAAAGCTGCTCACGATGGTCGTGTTCTTCTTCAGCCTCTCGAATGTGCTGCTCTTCCTGCACTTTTACGCGTACATGTTCAACGGCGTCG
GCGNNNNNNNNNNTCTCGTACTCGGCCAAGATGATGCAGGTGTTTGTGCGCGTGGGCACGATCCTGCTGGCCATGCTCGTCGCCAAGGGCTGGACGATCA
ACAGCGTCGCGCTCGAGGGCCAGGAGAAGCTCTCGTGCCTCATGATCTCGATCCTTGGCCTCTACCTGTCGATGGCGATGTGGTACCTCATCTGNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCTGCTCGGCGCACTCGTCTGGTTTGTCAACACGAT
CCTCGAGACCCGGTCATACGAAGAAGCGGCGGCCAAACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTATGTTGGTATTGTATGTGTCTTTGTATTGG
CTCTGGCAGCAAACGCGTCTAACTCTTGTGGACTACCATTGTGTGTTTGGCAAAAAAAACTTAGATTGCGTGCTTGTTCTCGGTGTACATTGTCGCGCTG
CCTGTGATCGTGCTGCTCGCGTCGTTTCTGTCGCCGTGGGTACGTGAAAAGACCGTCGCGGCGATCTCGACGAGCGTCGAACTCTGCGTCTACACTGCGT
TGATCTACTTGCTCTGGCCGTCGCGCGCACCACACTACTTTGAGGTACCGTCACGCATCCCTGGTTTTACCCCTTTCGTACCTTGTCGTTGCTGATGCTA
AACTGTATTTTGTTTGCTCTTGCGTCAAATTAGCGACTCTATTCGGTGTCGTCTCCCTCGGAGAAGGCGACGCTGCGAGAGCAGCACCTGCCGACGGAGG
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGTGCGGATCGCTGTCTCCTACAATGAGTTTCTCTATTTTCTTTATTGCTATTGCGTTTTTTC
TTTATTAACGTCTCCCAAGTATACGTGGCAAACAGCAAGAACTGTGATTGTGTCCGCATGTTTGTTTGTGTTAAATCACGAATTTGTTGAGCACGTGGCG
GCATTTCCAGTACAAGTCAAGCGTCTTGGTCTCGATACGCGCGAGGTCTGCGAGCATACGCACGACTTCGTCCGTGCACAGCGATGACGACGACACAGAG
CGCAGTTGAGTCGCGATTTTCTCGTCCACAGCCTAGACAAGAACAATCAAGTTGTGTATGCGAGTTGTAGACAAGTAAGAATAACCAAGCCAACAAATGC
AAACGTACCGCTGCGAGAGCCATTGTCTCCTCTATGGGCTCGCGGAAATCCGCAGTCTCGAGTGACAATGCTGCAAACACGTCGCTCAGAGGCATGGACA
TGTCTTCGTAGCCAGGTGAACGAGGCACGCTCTCTAGCAGCAACGCGCGCATCTACGTGGGTCATACGCGACTTTAGAGCCAACTACCATTTTTTTTATC
AGCAACAAAACAAGTAAACAGTGTCGTACCGCAGACAGATCTTCGTGATCGGAGCACTGCAACACGATCTCCAGAGGTCGCAGCAGCTCACCGTCCATGA
AAATCGTGCCCTCGGCGAGCGCAAAGCGCAGCACAATGACGTTTCCTGAGCGTGTTTGCATCCCGATCCAGAATTTACTTCCAACGCCACGTTGGCTCCG
ACAGCTTGCACGCACGTGTGGGGCTTTACTCGACGGCAGCTGCATCACTTGAAGGACGATCGCGGTCACGTTGTCGACATGGAGCTCCTGGAATGCACAC
GCTGGGAACACCATCGTGAAGCGCAAGGGCGGCACGAGCTCGCCATGAGCATGGGGCTGCTGTTGCGTGTCTCGCCACCGAAGGCTCGCAAAGCCGGGAT
GCTCGTCCCAGTGCGTCGACAGCGCCGACCACAGNNNNNNNNNNNNNNNNNNNNNNNNNNCCTGCTTGCTGCTGTTGGGCTTGTTTCTCATCCAAAGAAA
CAACGCTGCGCTGGGGAATAACATTTGAGAGCAGCGGGTCCTGGTCCTGACGGAACGCCGTGNNNNNNNNNNNNNNNNNGATCGTCGTGTGGCTCATGGG
GATCTCGCGTTCCTCCAGGATGTCGCTGAGCCGCACGAGGTGGAAAGCCTGATCGCGCACCAACGGGATGACGAATGAGAATAATGTCGCACTGTTTGTT
TCCTTTTGCTCGCCTTCGACAGCCAGGTGACCTGGCTGGAACACTAGGCTGCACGAAACCAGCAGCACGCCGTCCTCGTGATGCGCCAACGTATCTCTCG
GCAGTTGCAGCACTTTCTCACCACCGAGCGCTCGGGTGCGACGATCTACGAGCGGAAACACGAACGTGGCCACCTGCTCACTCCGCAAGCGTACATGTAC
CGACACGAGCCTACAGAACAAACAAAACAGGATCGTCACATCATAAGTAGCATATCCGAGGATGCAAGTAAGCGCGTCGGGGGTCGCTTCGTACCAGCAT
GAGAGCGAGTGAACATTGTCGGGCTTGTTGACGTGGATCCGAGATGTGAGTCGCAACGCCTTGCTTTCCGCGAATGCACCAGTCGGGTCCATCGTAAGAC
TCAGTTTGCACTGACAAATAGATTCAATACCTCCTGCGTATACACAATTTCAAATACAAGCATGGCAGCAACAGCATTTGCTTCATTTGCTTTGCATTCC
GCCGCTATGATACATGTTGTTACTACGCACCTTGCGTGGCGACATGGCGCTGAAGTTGCAGTGCTGCGCGCAGCGTGCCAAGATGTGCGTCCAGTTGGTC
CGAGTGCGCGCGTAGCTTTGCCACCACTGTCGAGACGTCTGCGATTCGCTGCAGAAGCAATCTGATGCGCGTTTCGTTGTTGCTGGTGGCCAAATTGAGG
CCTCCAGTCGTCCTTGTGATCGCATTTGCTGTGTCGGATGACGGCGATGGCGAGAGCTCAAGGATGCGCGCGATAGTCTCCTGGACTCGCGCACNNNNNN
NNNNNNNNNNNNNNNATCGACAGCACACGCCCAGACGCACACACACACGTGAGCGCGTGCTCACTTTCGTGCACTGCGATGACCACAATTCCCTGCAGAA
AACCACGATTTGCACACATAGTTCAGTGAAAAGCAACAGTCCACAAGTGTCGCTGTGACTTTTGTACCGGTGGGAATGGCAACTTGACAGAGGGATCTGG
CAGCATAGGTGGTTGAATAACACTCGCGTCGTCATCGTTGTTGCCCTTTGACGCTTGCTGCCGTACAAGATCGCTCGCTCGAAAGGCGTACGTGGTGCCT
CGAGCGCAATACACAAAGCATCCGAGCCAATGCAGAAACACGAGCGACTGAATCGGTGCTGCCAGTTGGACACTTGGAAGTCCCGTAAGTGGGAGCACCA
GTGGAGGGTGGTGCTTGCCCAACGGTGGCTGCTNNNNNNNNNNNNNNNNNNNNNNGATGCGCGCGCCCATCGGCACCGACGACGAAGATTCCGTGAACGT
TGCTTGCCATCGAGGCCCCTGACGCACTCGAGAATGGCACAATGAACTGCACGTGCTGTCGAATCTCCACCAGTGTCCCCGTGCATGTAGCTGACGCTGC
CACGCTGTTGCTTAGCTGTCCGCTCGTATCGCTGCGAGGTATATGTGTCAGGACAAAGCGAACGACGCCGTCAATATCGCCCTGAAGCACCAGCACACTC
GCTTGCGTGAGGTAGTGGCTCTCCGTCTCTGGGAAGAGCCATTGCAAGAGCGCGTGGTTGACTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTCGACCGCTGCGAGAGTGTCAGTGTTATTGACTGCGTGACCTGGGGGACTCCACAC
CAGCGTTGTAGGCGAGAGTACGCTCGTGAATACCGCGACACTACTACCATTGCACCGAAGATGGTGCGCAACGGTTTGCACACCCGGCAAGGTGAACACG
AGCTCCATTCGACACACATCCGGACTGCCAAGCGAGTCAAAGAAGGGTATATGAGCCAACGCATATGCATACAATGCATAAGCAAGCACAAAACTTACTC
AGTACAAGACGCGTCCTTTGCACTTTGTGGCAGCACGATCGGATGCAGAGCTCTAAGGGGTTTGGACGGCAGCGTCACGCGCCAGATGTGTCCATCGATG
ACGGCGACGAGTAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTGCTGTTGCGCGCTGTCACTGTCGTGACTCGAGCGAATTGCGCACAC
ATCGACGATTGGCACGGATGAGCGGAGTACACACTACGCACACATTATAACACACTATCAGAGAACGCGTTGCGCACGACACAATAACCAGCAAACTGAC
TCCAAACCGTTCCGCACCTGGATCGCGCCATTCACGATGCAATGCACGAGCGTCGCGCGCAATTTCACGGCCACGCACAGCAGCAGCTGCTGGTCTCCGT
TTATCGCACGGTGCAGCGCTGCAGCACACGGCCGTCGGTCGGCCACGCGCGCCAACTGAGCAGCAAATTGCACACCCTTGCCGCCCGGATCGTCCATTGC
CATTTGCAGCGCGCAACACAAATATGGCGCCAAAGACTCCTTTTTAACTGGAGCTCAGAATTGTTGCTAAAACAACGTGTGCTAATTCGAACCTTCATCA
TGATAACACTTCTCAGTGCATGAGTCAAGAATGTTTGTCAAATTTGATAATTTGTCCACTTGTCTTCTAATAACTTTTTTCAGTACATATCTGTAGGAGT
GTATGCCATACTCGTGTATTTCAAAACCTAATCGCTGATTCGTACCTACAAAAGGATAAATAACTCTTCTCAGTTTATGTTGCGTGAGTGAAGGTCGTTA
TGATCCCCTTCCCAGAGCGCCGCCATCTAACAACATCGGCACTCTTCGACAACAGCTCTTTTCGAGGCACCCCACCAGCCATTGCTCTTCCTTCGGCCCT
CCCGCCCCCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTCACTGCG
ACGTGCACGGCACTGCATCCGCGCGAACCAATCGTGCAGGACGCCGTTGCGCTCGTAGTGAAGCATCGGTTTGGCGATGTGCTTGCATCGCTGCGAGAGG
ACGACCCGCTGTGGCCCCGATCTGTGATCATTCTGCGCGTAGCGGAGGTGCTGACACTCAAAAAATGGCTGGGCAGTGCGTCGGTGCAGTCATACGAGGA
TGCGGCGGCGTCGTGTGCGTNNNNNNNNNNNNNNNNNNNNNNNAGCAGCGTTATTGTGAGCAAGGCGTGGTTCCTGGCGTGGAAGAAACGCAGTCAAGGA
TACGAGCAGTTCCTGATGCAGTTTCGCCACACGAAGAAAAAGCAGCAGCAGCGCGTACGGCAACAACAGTCACGTTCCAAGAAAGAGAAGAAGCTTGGGA
CGTGGACGAACGATGCGGTTGCTGTAGTGCACAAAGTTGCCGATACCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCCGGGGACTTGG
TCGTGTGTCAGCATGGAGACCTGCTTCCAGTGTCCTCATGCGTTGGACGCTCGAAGCGCGTGGTTATCTCCAAGTCCATGTTCACCAAGATGTCGCTGTA
TGCGCCTGACCTACACGGGTTTCCGTTGTACTCCTCAGACTGCGAGAAGTGCACGCAAGAGAAAGAAGCGAAGGAGCGTGAGGTGGAGCAGCGCAGACAA
GAACGCTTCGAGTCGCAGATTGCCGGCTCGAACGATCTACTGGATCTGCTGCTGCGCAAGTCCGGGTACCCGAATGAGTTGTTTTCGCCTGCGAGCTCTC
GAGGCAACACACACCTGTCCCTCCACCATAGCGTCGGCAAGACGTACTTTTTAGTCCCGAAGAAATGGCTCATCAAGTGGCGCAACTTTGTGCGCAGCCT
TGACAATGCCGGGTACCCGGGGCCCATCTTGAACGCTGAGCTCGTGTGTCTCGCGCACCAGCGCAACGTTGTGCCGCCGTACATCACCATGTTCCTGTCG
GGCTTCTCCATTGAGCAATCGCTGCAGGCCACGCAGGCGTACGTTCCCGACTACTCTCTTACATGCTGCATGGCGATTGCTCCTCATTCTAATTTGTTTT
CTTTGTGAAATAGACTTGGCACATGTGCGTCCAAGCAGTACGAGATCGTGACTCTGGGCGAGTGGGAGGCGCTGTACGACCGGTATTGCGCCGAGTACGC
GGTGGGCTTTGACGTCTTTGACGGCTCGTACCATTGGCAGACTCAGGAGTGCAACATTTGCTACTATGGGATGGGCGGCTCCGGCACGGAGAAACGACGT
AATGCGAGTCGCTGAGACTGAAACATAAGAGCCAATCTAGACGGGTAATTGTACTTATTATGTCGACTGAATCGACCGCATGCCATCAATAGAGTCAACA
CACAAGCGAAAACACTCACGTCTTACTGGTGGTGAACCCTTTTTCTCGCTAACATTGACGGCTGGAACTGTGCTCGCAGATTTACTTGGTCAATTCTTAG
TGCGCCTAGGTCTGTGGTGGTGGTGCGTCATTGCCGTCACCACGGAGCAATTCATCGTGCAGGCGTTGCTCTGCCGCGTCTTCTTCTTCGTCGTCTTCAA
CGAGGTTGGGGAGCCGAATATCCATGGACGGGAATCCGCGCTGTTGCTCTGCTAGCTCCTGCTCCTGAACCAAACCGCAAATGTCCTGCAGACTCTGGAG
AGGGTACCTGCCATTGCTGTTTGCGAGCTTGAGACGTCGAAACGCGTCGAGCATTGCTGGTACGCTGAAAGACTCAAAGCTCAGCTGACCGTATCGTGCC
GTCTGCGACTCGTAGCACGCGTAATTAAACGCTTTGCGCCAGCGCTTGACAACTTCAGCCTTGATGCGCGCCTTGCGGTCGGCTTTGTCTTCGAGGAACA
GGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGATGCCGAAAAACGTGACGGCGATGCACGTCCCGACGAGCA
GGATGCTCAAGAGGCTCTTGTTGATGAGCGATTCCTCGTTCATGTCGTTCAGCCGGATCATGACGCCCAGCCAGAGCGTGAGGAAGAGTTGCAACTGCGT
CACGCTCGCAATGAGGTTGTCCGAATACTCGCCGTATGGCTGGAAGTACAACAGGAACCACATCGTGACGAGACTGAATTTGGACAAGGATTGCAAAAAA
AGAACACACAGAATTGGTGAGGAGGCAAAAGAAAGTAGCTGGACGGCGAGCAAGACGCACCAGACTGAGAGCGCAAGCAACACTTGCTCGACGCTTCCAT
TTTGGACAAACACGATCACGCCGCTCAGGAAAAGCTTGCGCGACAAATCGACGACTTCGAACCACCAGTATGCTTGGGAATCTATGCACACATGCAAACA
AAAAAAAGCAATTCACAAGTCAGCCTTCGCTCCACAAGCCAATCACACACAAAAGGAGTGTGCGTACAGTCGGCGTAAATGAATCCCAGGCGCGCTTCCA
CTGTGGAATCCTACAAGTTCATATCACAAGCGACGACGCGTCAGTCGGTCGAAATCTCACAAAAAAGTGAGATGCCTGCACTAACCTTTAGGTTCTTGCG
CTTCATGTATTTCGCGAGCTCTTCATCCTGGACATCGATGTTGTCCATGTCAGGAACGCAGACGCCATCTTCAGTGTGCTGCTGGAGCACTTCCTTGAGC
CATTTATTGCGCAGCTTTCTGCATTGCGGTTTGCGCAGCAACCGCAGCCGCTCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGCTAGCCGA
ATCAAGACCCAGAAAAAGAATGGGATGCCTACAACCCAGACGACGACACCCGCCATCGCGATGACGCCAAAGACCGCCCACGTCGAGTTGTAGCACACGA
TGCGCCGGTCGACGACCAAGTACCGCGTGTCGCCGATCTCCTGGCAGTTGAAGATCATCAGAATGGTCTTCGAGACAGTCGGGTACAGAAACAGCGCAAC
CCAGCAGTACAGCTTGAGGCATTTGTTCCGGTACGTGAGGTAGTTCATGCGCAGCTTCACACGCGCCTGCCACACGCGGAGGTTGCTTCGNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNGCTCGAGAATCTTACCGCTTAGCACGAGCTTCGTCGTCGGGCATTGCGCGTGGATCGATCGGAAGAGACCGAGTTT
TGGTGTCTTCACCTGGGACATCCCGAATTCGCGCTTGAGTCGGCGAGTCTCGGCCTTGACCGTCGGTGCACTCCTGTGACGATGCGTTGGATCATTTGTT
GATATGGGCGTGGATGCGTTGTTACGAAGCTCCTTCCGACCTCTCCACCACGCCTTCACGAGCACAATGGGATTCATACTCACGTCGTCGTTTCGCACTC
TCTCGCCTTCGAGCACAGGAAGGCCACACTTCAAGCAGTTCCGAGGAATTAACAGCAACTTTGCACTGTAGCTGCGCATACCGGCGTAGAAGTACGCCGT
GATCACCGAGAGTGTCACGACGACGAGCAGCACCGTAACACTATACACATTTGCACGAACGCACATACACACCGTAAGGCCAACTGAAGTCACGACTTTC
AAGAAAACACATGAAAAGCATACGTGAAGTCAAAGTAAAAGGTCGTCGAGATCACGCAGTCGATGCCAGCAATTGCAACGAGATCCTGCCATAAATATCA
TCAGCACGCGGTAAGCATTGCTCATCCTCTAGCGGCACTAACTGCAAACAGAACACTTATGCTGCTTCACGGTACCAGATTAAATTGCTGGGAAACATTC
ATAATCCGTTGAATGTCGGGAGACCATTTGATCACAAACGAGTCGCGGAAATTGCCAAAGATCTGGAAAAATCCAATAAAGATCTTGAATTTGCCTGGCT
TGATGGGAAACTGGCGCGATGTAGGCTCAACCTCGATCCCGAATAGCATCTTTGCGTTTTTCTTCTTGGTCTTTTCCCTGAACCGGTTCTTGAATTGCTC
CAAACGGGACTGAACGACCACAGATTGCCGGCGGTATCGCTCTCTCGCAACCTGGACCACGCTTTGCCGTCGTTTGATCAATTGCGGAGGCTTGAGGCGG
CGATCCGCCTCAGCTTTCTGGAGGAGCGCGATTTCTGTGAGGTCGCGCAAGTAATATCGAATCGCAGCCACCGCTGCTATCGCGCCAAGGACAATGAAAA
TCGGGATCACAAAGTTTTGCCACCGAATTGACGCGCGCACTTCGGCATTTGCTTTGTCGCAAGCTGTATTGTTGAAATATGGGAGATACATTCCGTGAGC
CATCGTGCAATGCAGATAGAAACAAAATAAAGAAAAACGTGCAACGTTGACTCACGCAGACAGGAGTTGTCTTTAGTCTTTTTGTATCGATCAGCGCAGA
CCGAGCAAATTGCGAGGTCGTATCCTTCCGCACACGAGCTATTTGCTGGTTGCGTTGATTGGAGCTCCACCGTGATATCAGACTGGCAAGCTCCCGTGAC
CTACATCCACCATATACATGTTATGTTTTCGGCCCATCAAAAGCAAGGTCAAAGCGTTCCCTAGGCTCGAAAGATATAGGCAAGAAGCATACCTCGCAAG
CATAAAACGCCTTGCCCGCGACGCACGAAAACGTACGATCCGCCGACCAGTACTTGTTGAACTCACTCGACGTCGCACAGGAATGCAGCACATCCGAGAT
GTTCACGCCCGGTTCAGCGTACGGCTTGCACGGATCGTCACTTTTCCACTGTGACGGGTTGCAATTGCGAATCTGCTTGGACTGCGGCGCCGTGAACAAG
TAGTAGCCCTCCGTGGTGCGTGGCGACGTGGTCCCGTACTCGACACCGAGAGTCTCGGTGGCGCGGCGTACTGTCATGTTGCATTGCGCACCAGTCGGAC
AATTGTAACAACGGAATCCGTCCATGCTGGAGTATGGATACAACACGCAATCGAAATGTGAATTAGTCAACAATGGTACGTGCCTGGACCAATTGCAGCT
CCATTCTTTTGAGAAAGCAGAGAGCGTACCTGTACTTGTTCTTGGGACATCGAGAACATTTGTTACTGGGAAGAGCAAATATTCGAAACAGAGCACATGC
GTGGTTAGTCCCCACCTTCCCCACGAATTCAAATATATCCAAGCCACAGCATTGACTTACTCATTGTCTGTCGAGAACCCCGGCTCACAGGCGAGCACCT
GAATATTGGTCGAAAACGAAATATCTTTTTCGTTTCGTGGAAGCGCACATGTCATTTTGAGTTCGTAAGTTTCGTTCCTTGGATCGGTCTTGAACATTGC
GTCTTTATACAAGATGATGCCCGCACTTGCAGCCGTGTAATCGTGCGGCTTGAAATTCAGTCGACTGCTAGCCGTGCTGTCCTTTGCAAGCGGCGTGACG
ATGCATTCCGTCTCCGTGTCCAGTACTTCAATTTGTCCGTAGAGGTCAATCGCTTTAAGCCGAGGCCACACGAACTGCGTCTCAGAGACGCTGTGGTTGA
GCGATTCCAACGGCTTGAACGATTCTTCGTCAGGAGGCTCCAGCACAGCGATCCCACTATACACGACACTTGGCCACCACATCACTTGGACATCTCTCGT
GTTCGTCGCTACGTCATAGAGCGAATTGTTGACCATGACGCACGACGTACATGGATCCCGCACGGCAACAGTTTCTGCATCTTCGAAGGTATGCCAAAAG
ATGCAACCACCGCTTGGGGCGACATTCGAGTCGCAAGTGACCTCACTTGTCGTGATGTTCGTAATCAACTCGTAGTAGAATGCGCCACCACGAAGCCGCG
CGACATTGCTTGTGAACTGACTGTTGGCTAACAGTGCAACCTTTGCCGTTTTGACAAAGACAGCACCCCCATAAGTCGCCGAGTTGAAAGTGAACGCCGA
CATTGTCATATTCATGATGACCGCATCTGTGACATAGATGGCTCCACCGCTAAGCAGTGCGCGATTCGCCAAAAATGTGATCCCACTAAGTGTCACTTTG
CTCGAATCGGTAGCAGAGACACCGCCACCATTCTCGGCTTCGTTACGCTCGAACGTCGACGTTCCGTCAATGGTGACGGTCGCTGTGATCGCCACCGCGA
CAGCACCACCAAACTGGTCAGCACTATTGCCCGAAAAGGACGTGCCTCCACCAATCGTAACCGTGCTGTTTCGGTCGGCGTGAATCGCACCACCTGTCAC
CGCAGTGTTGTTGACAAACCGACAATCCTGGATATCAACGTGACCATCGGCGGATGTGATGCCACCACCGCCTTCATTTTTTCCCGTAATCGAGATTCCG
CCATTCAACGCGTATAGTGAGCCCACAGTGTTCAAAAAGGCATCTCGGCCAACGTACACGCCTGGGAGATATCAAAATCGTTTTGTCCACAGAGTTAAGA
GAAAAGAAACTCAAGGGAAATCTGACAAAGCAAAACCTACCGCAGCCTTGGCCCTTGGCCATGTTGCCCGTGATCACGCTTGACTCAATGGTGGCGCCGA
CGTAATCCCCCGTGTCAAGGTAGATGCCGCCCCCAGAATCGTCAGCGACGTTGTCAACAATGGACGAATTCACGACAAACACCTGCGACGAGTCTTGAAC
ATAGATTCCGCCGCCATAATTGTTGGACACTGGCATAAAGCCAAGTACACATATTCAATCGGTTAGTTTTCCTGCATTCGCATGCTAGCACATCAGCAGA
TTACCAGATTTGAAACGTACCACTGGCGCGTACAAAAGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTCGGCGCCACTTCCAGTCACAAA
CACACTGCCGCCGGCTTCTTTCGCTTGATTGTTGGAAAATTCCGATTGCTGAATGTACATAATCGCACTGCTGTCGACACACGCACCACCACCTGACTCG
GCACTGCCACCGGTCAGCGTCGCATTAGTGAGCGTCATCTCCGTGTTTTCCCCACTGATAAACACAAGGTGGCCACGGCGGGCGGTGACATTGAAGTCTT
GATTCGCTCGCTCGGCTTGGTATGCTGCACCGCCCACGAGCTGCGCGAAAAGGTCTCTCCATACGGGCGTAAACCGATNNNNNNNNNNNNNNNNNNNNNN
NGTGTCGCCCGTGACACACGAATCGTCGAGGTTTGCCGTGGACTCAGCATCAACAGCGATGGAGCCCCCATAAAGCGCTCGATTGTGCACGAACAAGCTC
TCGGAGAGCTGCAACGTCGACTTGGAGTGCGCGTACACTCCGCCACCGATCCCAGATTCGTTCTGGGTCGCGCGATTCTCGAGCATGAGTAGCTCAGTTC
CTGTGAATGTCGACGTGGCAGTGACAAACACGCCGCCTCCCTGCTGTAACGCAGTATTGTTGTAAATAACGCTCTTACGTATTTCGGCATGCGACGCGAT
GTTGCTTGTACTCTCAATGCTCAGCGCGGCGCCACCACTGCGCGCAACGTTTTCTGTAAAACTGCACAATGTGAGAATCGTCGAGTTTGCACCGGCAACC
GCGATGCCACCACCTTGGCTGGCTTGGTTCTTCGAGACTAAGATCGATGTGATTCGAATCATGCCTTCCCCCGTGACGAATACGCCGCCGCCTTTGCCGT
TCGCGACGACCCCACGCGTGATAAGAAATCCAGCGATCTCACACACATCGACGCACTCGATCAGTGCGTTGGCGCCATTTTCTGAAGCGTCCGTGAGAAA
GTTGGCATCCAATTGGGACCTTATTGCTGCAGCATTGTCGTTGAATAGCGTGGCTGAAACAGGAGAAGCTGTCTTTGTGCTACTCAGATAGAGTCCACCT
CCATTTTTCGCACTGTTAAACCGCATTGTGACGTTCGAGTGCTGAATTGAGGTGTGCTGCAGTGCGATACCACCGCCTGCTTGACTCGCGACATTCCATT
CGACACGCGAGTCTGTGAACACACAGGCAGCGTTTTCACCGAAATACACCCCGCCGCCAAAACGTCCTGCACTTGCATTCTGAATCAAGCCATTTGAGAT
CGTGCATCGTACAGCGTTTTCCGATGCGAGTCCACCGCCACTGTCCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGACCCTGAATGCGTCTACT
GACGAATCGGTGCCACCAATGAAGACGCCACCACCGAGGCTGGTGGCTTCATTGCCTAGGAACACAGCCAGTGTGGCGCGACCGAGTGGAGATGCAGCCG
TGAACGACGACGATTCAAGGTACAGCCCGGCACCTTTGTTGGCAGCGCAGGCTAATACGCTTACGCCATCGTGTAACGCGCGTGCATTCACGAGGTATAC
ACCACCACCAACTCCACCCACAGATGTGCACGCTGCCACGCTCACGTCGCGCAATGTTAATGTGCCGTCGCCAGCGTAGACACCGCCACCACCGATCTTT
GCAGTGCACGAGTCCACTAACACCCCCTTTAGAGTGGTGCTGCCCGATGACACGACTCCTCCTCCACGCATCGCGTTATTGAAAGCCAAAGTGAGTGTGC
CGTCGATAGTTGACGCGAGCGCGTAAAGTCCACCTCCACTGACAGCCGTGTTGCTGGTTGCGGCCACTGACGTGATTAAGAGCGTTGATAAACTTGCAAA
TAGACCGCCACCACTGTTTTGTGCTTCGTTGCCAACGATCTCGATATTCAAAATGCGCGTCTGCAGTGCGTCAAGGACTGCAATGCCACCTCCACGCGGC
GCCACGCACTTGGAGATCGTGAAGCCACTCAATGTGGGTTGCGCCCCACCAAGAAATACTCCGCCTCCGGCTATTGTTGCACTGTTTTCTTCCACCCTCG
TGTTGATGCCTGCAAAGGAACTGGTGTCGATGTACACTCCAGCACCATTCGAGCCGCTGTTTAAGTGAAGAACAGAGTCAACAATGTCGATTGTGCTGCG
ATTACCTATGTAAATCCCGCCTCCATTTTCAGCCGAGCAGCTTTCAAGCCGCAGTCCTGTGAGGCGATTAAGTCCATGCCGAAGTGCCATGCATCCTCCT
CCGGCCGTTGCCGAGCACGACGTCACCACCAGGCCGCGGATTTGTGCACCTGACCACTCGCCATATGCACCGCCACCTAGAACTGCAACAATGCACAGTA
AAGCACAACTCGAGATTAGATCAAAAAGAGGAAACTGGTTGGGCACGATGAGACTCATAGGCAAGGGGCGTACCTGCTTTGTTTTGCGAAACGAGTGAGT
CGGTATCAAAGACGATACTTTCATTGGTCGTGACGAATATACCGCCACCATTCCGCAATGCCTCATTGCCTGAGATGGATGCTTTTGTCGATGCCAGCGC
AGCTTTCCGGAGAAGGGCGACACCGCCGCCGTCATGTCGTGCAATGTTTTCACGAACGTCGCACTGTGACACCACGACACTTGCATCTTCGGCAGCAAAC
CCGCCACCGACTTGGGCTGAATTTTTCTGAATTGTGAGCAACGTGGCGTCAATCATACCCGTGAAAAACATGCCGCCCCCTCGCGCATCTGCAACATTCG
CCTCAATTACGGTTGTCGTTCCTGCGCCAATCAGGGTAGCCGTTCCCTTTGCGTATACTCCGGCACCATCAATCGCACGGCACGCAACGATCTGAGAATC
CTCTATGGTCATCGTCACTGTGTCGACAAATACGCCACCACCGTGTTGTATCGCGTTGCAGTTCTTAACGGTCGTACCTCGCAGGGTGACGTCGGAACGG
GAGACGTACATGCATCCACCATGTTGGTGCGCGAGTGCGTTCAAGATGTGCATGCCGTCCAAAATGGCATGGCTGGAAACCACTTTTACNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNAGTAGCAACAGTGTTACGGATCTCAAAGTCGACGAGTTCCACTTTTGCACTTGAAATCGTGATCCCGTTTAAGGAGTTTG
CACAATCCAATGCCGTGACGGACGGACCACGAATACCTCGAAGATTGACATCTTTGTTCACAAGCAAGCCGCAATTCCGAGGTCCGCTGTACACACCAGG
GTAGATCAGCACAGTTTGGCCCGTTGTTGCGATTTGAATCGCACGAGAAAGCGTCGCTACGGCCTTTGGGGCAGTTCCGACTTGTGATGAGTCCATGAGC
TCACCGGTGCCCTGGGTGTCGTTCCCGTATGGACTGACGACGATCACCTTGCTTGGTTCTTGACAGATCCGGTCACATGGCGCATCATTGGTACAGGTAG
TGAGGTCGCGTGGGCACACCACTTGATTACTGCAATCCTCACCGATGTACCCGCTCAAGCATGTACAAAAGCCGTCACGGCATGCGCCGTTGTCCGAGCA
AATCGCTGGCCCGGGACACGGGATCGTCGCACTCGCAGCTGTGCTTGCCTCAAGCTCATAGGTCATGAGGAAACCCGAGTGCGTGACACTGATATCCGAG
GTAAATGTGATCATGAGGGATTGCACGTTGTTCTCGGTTGTAAGTATAAATGCGCCGTCACGGCGGCATCCGCCTTCCCACAGTGGCGTCGTCTCGCCCT
CCACGTTAAGGGTACTGATCACAACACTGTCATGGTCGCACTCGAGCCAAAATGCCGTAATCTGTGGCCACGTCGACACATCAAGCGAACAGCAAAAGTT
AGCCAACAGTTCAATCGTCTAAGGAATAGGCTTATACACACAGAGACACGTACGTTCAAAATGATCCCTGTTGGAGTAGCAGGAGTAATCTTCCACTGAC
GGTTGAACTGATTCGCGTAGTTTTGAAGTTGAATAGCTCCTTTTACGCCCATGCATTCAAACGCGTCCAATGGAGTAGACGCGCTGGCAACAAACGTCGT
CGCTTCACTCGCGATCGAAAGGGTACCATCAGCGTTTCGCACACGGAGTGTGTACACGTACGTATTACCAGCTATGATCGAATTGTCTTCAGCGTAGGCG
TCTGCACCGGAATACACCAGCTTAGAGCCATCTCGATACAAAAAATATTCTACCGCCTCCTGTATCGTGACCCAATAGAGCGATACAATGGAACGGGACG
CTACGAACAGTAAACGAGAGATATCAACATTAGTCGTGAGTTCCCATACGCAGAGAGTCGAGAGCAAGGCACTGCACATAGACGCAGATCCCTGCCACGA
AAATACAGAATTTCATACCGCATCCGATAATTGGCGGCTGAGGCTGCCCTTCGTACAGCGACGTCATAAAATAGACACGCTTACTCGGAATTCCCAAGTC
GCCATCACCGGTTTTCGCAGTCTATTGACATGTCAGTATGTGTTAGTGATGCAGAGCGAATAAAAGCAATGGTGTTGGGACTTACAATGATGGCATAGTA
TTCCACATTGGGTGATAGTTTCTCCACCGTTGCATTAAGCGTCGTGATCGGGACACTCGCCGTCGCAACGTTCGCTGGGTTATTCACCTCGACGACTTCG
ATTTCGTACGTTTCAACGTAGTTACCACCAAAATCGATGCACGCATCCCAATCCAGGAGCACAATTGTGTTCGTGACACTCACAACACGCAAATTTTGCG
GCGCCTGCGGCTGCGTGACCAGACTAGTCATGAACACGACAGGCTCACTCGGCTGTGACGCGCCGACTGAGTTGTATGCCGTCAGCACCACGGTATACTC
GATTAGAGACTGGAGATCGCCTATCATGCAAGAGTGAATCAATCCTTCGCATCTTCCAACGACGTCACCATCCGTTGTAGTTACGATCAGCACGTAGGAC
GTCAAGGGCACGCCGCCCGTATCCACCGGATCATACCATGCGAGAGACAATGAACCGCCTGTGATGGCGCGTGAGCTCGGAGATGCTGGTTGCTCTGGGG
GTCCGACTTCTAAAGTGAGTCCTGAAATACTGCCAGTCGAGTCACTGCTTCCCGCTGCGTTTGCTACTTTCAGCGAAAACGTGTACAACGTGGTTGGAAG
CAGTCCACCCACTTGAATGGCGATGAGGGTCTCATCCGACGAGGCCAAGCGTCGGCTAGTGCGTGCAGCTGATACGGTGGACGTAGGNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTACGCGCACACCATTTGCGTAGATCTCAAATGAAAGACTCGCAATGTCGACCCCGCCCGTATTCT
TCGGTGCGGTAATCTCGAGCGTTGCGGCGCCTCCAGACACCTCCCTGACTGTAATGGACGTTGGCTCCGATGGTACTGAGATGTCGCCCGTCCGAAGCAC
GGTCGCGACACCATCCAATCCTTGTCCAAGCGCATTCACAGCATACACTGTGAAGGTGTATTCCTTGTTAGCGAACAGGCCGCCAAACGCAACTATAGGG
TCTACAACCTGAACCTCGCGATTGTCGCCGCTGACAACATAGTTGGTGACGCCTTCGCCGCCGTTGTCACTTGGTGGCTTCCACGAAAACTGGATCATGC
CGCCCGACGTTGCCAGTTGCGTTACCTCTCCTACTGGACCAGGCACCGAGATAAATGTTGTGTTTAGTGTCGCAGCTGAGGAATTCTCCGAGTATCCGAC
TTCGTTCAAGGCCGACACCATAAACAGATACGGCTTTTCACTGTCAAGCTTAGTTTTCCAAAAGTACGTCCCCGTGAAGTTGTATACAAGCTCCCATGTT
GGCGCTTTTAGCCGAGAGCTCATGTACACTTGATAGAAAATATCGCCGTCGCTGCCGACGTCAACGGGAGTTTNNNNNNNNNNNNNNNNNNNNNACACGG
ATGCCACCGCCCGTCGCACCAGACTGATACAAATCTTTGACTCTGTTTGGAAGCGTCGGCGGTGTTGTCGTGAACACAGTTGGTTGGTCAAGTCGTGGAA
TCGTGACGGAGCACCCCGAGACGTCGTTTAATGGGACGTACACGAATCGATAGTCCGTGTCCGGTGCCAACCCACCCAATTCCACGGTGACCTCCAACTG
AAACGTACTATACGACACATAGTCGTAAAAGCCACCGATCACCTACCACAAAGGATAGCCAAGGTTAGCAAATGCTGCTCATATTGGTAGGTTGGCAAAA
TCCAGAACAAACCGTTTGCTCATTCAGGTAAAGATCAAAACCGTTGAGTTGTAAGCCACCTATGGACCCATTTGCACACACAAACATATCATACATGTAA
GTGTTACAGATTCACATCATT