Description :
From Genome Similarity Track
Location :
Scaffold_2240:343- 4561
Transcript NameFunction/comments
Phyta_totarag14279hypothetical protein

Sequence
4218 bases(100 bases per row)
GCTCGACTCCacttgtcttcgtcatctgTTGACCGATCTCCACCATTCTTGACCACTTCTGGCGTCGAATCTAGTTTCGATCTGCGTGCGATCTCATAGA
AATCGGCTTCTCGGAGCTCGTATAGGACCGACGCGTAGATCGCGAAGTCCTAAATGAAGCGACTGTAAAAACAAAATTGAGACTCCTCCAAaacgactgc
atcgatctCAGCGTAGTCGGTAAAGGTAGATCGGTCAGCGACAGCAGGTCCTTCGGGTGAGGTTCCAGTCCGTCCGCGGACACCTGATGGCCCAGNGAGG
ATGTCGTCAATATAAGATCGACACCCTAGCACCGACGATTCCTTTCCTTCGTCAGGTACTCCCTCCTCGAATACGTCGGTCTAGTTGGCGTGATCTTGAG
GAACCCATACAACGCATTGTCCACCAACCTCTGGTAGATCTGCGGCACGTTCTTCAACCTAAACGACATTCGATTCCATTCGAATAATCCGAAAACGCCG
GGATCGCGCGCGCTCTATCAGTCATAGACACCACCCAAAATTCACTAGCCATGTCCAACGAGCAATACCAGATGAGCTTGTCAAGATCGTCGAGTAGATC
GTTGATAAGCGGCATAGGGTACACCATTAGTCGAGTCAGGTTGATCAGGTGGTAGTCGATACAGAGTCTCATGTCGACTCcattcttcttgatgatTACG
ACGATCGGAGATGCCCATGGCGAGGTCGAGTGCCGGATGATCTTAGCTAATAGTATTCCTTTGATTAGCTGGAACAGCTTCTCACGGAACTGCGAAGCGA
CCTTGCGGACCCGTTGGGCTAATGGTCTTGCATTTTCCACATCAATGTCGCAAATCCCTCCCTTCGCATCAGATGACAAGGCGTTCCCCTTCCCAATTAG
AAGGTGTCAGCGACGCCAGTTGATCTTCACTAGtcgctcgatctcttccgCGTACTGTCCTCAGGGTTTCCCACTTGGATATCCTCGATCTTGACTTCTt
ccgtcgtcgacgtgaCCTCCGGCAATACCGCCATGTGACCCTCGAGATNCTCAGGGTTTTCTCCAATCCCTGCAAGTCGATCTTGAATGCGTTTCTGATT
TCCACCCATCTCTGCACCTCGATCTCGGCAATCACTTGAATCCTGACATCTACAATCACCTGAACCCTGACACTTGAATGCTGACATCTGCAGTCTTCTG
CATACATCGCCCTTTCTGCATCCGATACTGGGCGCTTGGTACACTCATCGGTGCTGACTTGTACATTCCCAGCCGGTGACAGGCCCGCGTTTCTTCCGTC
GTTGAGGCGCCTTCTCACAGAATCCTTTGGTCGTGTTCTCCGCCATCTCTGtcgtcgccaccgccgaGCTCTGCCACGTTTTGGCGGTCGCTCCAGCGGC
CGGGGCAAGATCGCAGTCGGTGTCTTGTACTGTGGCCGATCTACGGCAGGCTCCTGTGGCTCCTCAATTTTCTGGCGATCTTCATCGACATCCATCGCCG
CCTTGGTAGGCCAGGCTCTGCCATTCAGCATACCTGCGCGATCCCACCGAGATATATCCAAGTAAGCGTGGCACTCGATCTCCGGCCAGCCACATTCCAA
CGCGCATGTTGCGATCCAGTACTAACTTGCGGTCGCTCACGTTTATCAGCTGCAGGTAGCGTGTCTTGCCAGGACAAACTGTCAGGGTAGGCACCCAGCG
ACCTCCGTGGGTTACCCACAGCTACCGACTCTCGGTGGTTAGCTTCACCTCTGTCGACCCTCCAACGGCGACGTATCGATCTTCGTTCAAGGTTACTTGT
TCCACGTGGTCTCCGTAGAGTGGTCGTCTGCCGGCCAGTTGGACACGGACTTCACCGGGGAGACAGATTGTGCCGTCGGCAAGATCAAGACGGATACCAG
CAGGaaccatgaagtccatgccGAGGATCAAGTCCTGGCCGCCAGTTGACGGGCCTACCCagacgtcgaagaagtagATCAACGATCCAGCGAGCGTGAT
CTTGAGTCTGGTACGTACGTCCGCCGTGTGCAGGGATTTACCAACACCTTCACATCCCAGTGTCTGACTTTCGTCAATGTAGCACCCAGCTTTACGAGCA
AAGGCGGTGTCAATAATAGACACCTCGGCACCACTGTCAAATACCATGGTTGCTTTTCCGTTGTTGATCTTCCTCACAGCTTTCGCTtgcttgaacttct
tgtcaGGCATGTGGTACTTCCAGTATCCACGCGATTCTCCTGGCGAAATGTCCAACGCCATCGTCACACTTGATCTCGAATACTCATCAATCTTGTGCAA
ACTTGACACAGCAGTGGTAGGTGTTCCATGAAGATCACATGTATTGTCGATCGGATTCATATGCTGGCTAACCATCGACTCCGATTGTTTCTCGACATAT
GCATAGACGCAATACCCAGAACGCTCGTCTCGTACCGGGTTCAAAATCGGCGGGCGTCCTAGTTTAACatcttctccgccgtctccgccAGCATGTCTGC
GTGCTTGATGGAGTTGAACCACTGACGGATCAAGTTGTAAAACACTTCCATCGGGCATTGGCCAGCGTCGTGGATCTCACCGCAGGCCTTGCACACAAAG
AAGCATCGGTTAGATGGATGCCCCTTTCGGCGACACTTTTCGCAGGTCAAGCGTCCCTAAGCATCCAAGATCGGTATGCTTGCGCGACCCGCAGTGTGAG
CAGCGCTTAAACGACGTCCCCAGGTCAGTCGATCTGGTGTGCCGATCTTGCTATTGGTTCCGGGTCGCGTGGCCTGTACGGGCACGGTCTTGATCCGGTG
GCCCACGATCTTGTGGCTCGTCATGATTTCCAGCTGCCGTCAGGTACACTCAGCACAGTCCCGCTTCGCCGTTCGATCAGCCCGACTCCGCTTCCGACTC
ACTACTGTCGCCTGCCACGTGGATCGCGCGTACTGTTCGCGTAGGGGCTGACggtgtggctgctgtcggtgctcTCGTCCGGGTCTTGACCGATCCATAG
CCGCTCTTGCTCCGACGCGCCTTCGCACGCTGTCGAGATCGAAGCATTTCTTCCAAGGTATCGGCATCTGGGATTCGCAGCAGGGTGAGGTGGTCGGCGA
GGTCACGATCGTCCACCGTCTCGAtgaagtggtggacgtgTTCGCGTCGAGTCTCTGGAGATCCATATTTCACTTGGAGACGTGTACGGAGCCCAGCTAA
GTTGAGACGATGCAAATATTCCAGCGGCGACTCGTCTGATCACTTCCGCGCGTGGTAGTCCTTTCTCGCGACAGGTACGCCACAGCCGCAGTACTGCATC
TGGAAACTCAACAGCAGATCCTTCCAGTCATGCGGCTCAACTGTCGGAACCAATCCCGCGCCGGCCCAGTAAGAATATCACCGAAGACCAGGCACTATTC
TCATCATCAGGTGCTTGATCTCGGATGAACGCTGATTTCACTTTGCCGATCCAGGACCGGGCTCGATCTTCGTCGCCCTCCTTTCCAGTGAACTCCTTCA
GTTCGGACATTGCCGATACGCAGATGCGGGGGGCGGCTGTCGATCTGCCGGTCTGTGAAGTagctgtcgtcgccactGCTGTGTGAGTAGTCGTGGTAAG
ATCGAGGTCGTCTGGATCGTATTCCCATGTAGAGGAGTGGTGATTTGGCGATCCAACCGACTCCATCCCacgtcttgatctccagtcggTCACGTGGGCG
GGGGGTGGACTGTTGTTCCTTCAGGAAGCGTCCAATCGCAGCTTGAAAGTACGACGCCAGCCTCTCTGACGAGTGGCGAGTCGGGTTCACTGCTGTGACC
TTCGCCTCTTGGGCCGAGCTACTGCTTCGAGCTCAGCTCGGTCAGCCCGATCTCGCAACATGGCGGCGCCGGATGGTCCCAGCGTCATTCGCGGCGGGtc
atcgacgctgtcggAGTCTACTGCTTCATTTGTCGAGTCGTagtgcgacgacgtgctAGTCTGGCCGTTCGGAGCAAGTGTCAGCTGCGATCTCACGATC
TCCTTGGTGGATTGGCTGGTCGTGCCAACCAGGGGCTTCAGCGTCTCGAAGAGGGTCCTGAGCGCATGTTCGATCGCGCCAAGCTTTAGATCGAACAGCT
CGTCAGCTTCGAACGCACCCGCGATGATTCCAGACTCTTtcagcagttggagcaaCGCTTTCACCGCCTCCAGCTTGCTCGACCCAGTGATTGGTTTCGA
CACGGGACCCTTGAGGTC