Description :
From Genome Similarity Track
Location :
Scaffold_3602:343- 2478
Sequence
2135 bases(100 bases per row)
CTCTCAACTCTCAAGATCCGGTCACAGGAGGCGGCAGGTACGACGCAAAGGAACGCAAAGACAAGGGACACACCCGCAAGGCAACACTACGGCCAGATCC
ACGATCTAGGCCCAGAATCCATAAGCTCGAATATTCGCTTAGGATTCGGAACAATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCCATC
CCCACGTCTCGCCAAGCCACTCAAGCTTCACCACCACTTGGACTCTTCGGAAGTTACCGAGAGAGCAAGATCCCGCCCTACCGACGGGTACACAAGGTGA
GGAAAGTTCAGCAGAACACGGATCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCTGGCAATCTCGTAGATTTTGCT
GATCCCGCTACACCACAATGGTGCGCGTGCCCGGATCTTGTGGTGACTCGGGATTTCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGG
GGAAGAGGCGTCGTCGGAAGTCGGATCGACGAAGACGCTGCTGAATGAAACAAGATCCGCGGATCGATGGAGTCTTGGGAGGAACTCTGTCGACGGAAGA
GAGGTGGATCCGGATCCGGATCTAGAAGAAAAACCTCTCTATCCCCCCCAGGTCCCCTCGGGGACCCCTGCGGATCTTGATGCAAGTCAAGATCCGCTAA
CAAAACACGGAAAAGTGAAGGCGAAACGGTATGCATTTGCAGATTCACCGGTTAAGCCAACGCTGTACCTAAGCCCAACATCGCTAGTCGAAGAAACGAG
AAAGAAGACGAAACGAGTAAGACTACGCGGAAGAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAAGCTGGATCCAGGTCAAGCTGGTCAGACAAGAATC
TCGAGTTTGTGTATCGCCACCAAGCTTTACGCGACTTCCTGCATCAAGATCCTGTCATGCAGATCCTGAATCCACGCCAGATCAAAGATCCAAGGGAACC
GGTGAGAGCACCAACGAAAACGGCGAACAAGTTGGTGGCAGTCAAGGATCTATTACGTTTGCTTACGGAGTCAGGCATCGTAGCTGGTGTGTTCGACGCA
GAGGATATCTTCGAGCTAGACCTGGATCTCATAGTATCCGCGACGCGGGGCCTCTTTGCCAGAGTTAAGTCCATCACCGGAGAAAGGTCGCGCACTATGG
ATCCGGTGTCGTCGCCGAGGGTCAGCCAAGCTGCGTCCTCGAACTACAAATCCGCCGCTGAGGATGAGTCAGACACGTCGTCCGAACCACGACGCATGAC
TTTAGGACCCTCCGGGGCATCCATGCTGGAAGCGCGGGCGAGGAGCCGAGGACAGGAAGTCCCTGTGAGCGCGAAGGCTCGGGATCCAGTAGGCCCCACG
CGTGATCTGACACAATCCAGCCACGATCGAGCCAGATCCGGCAAGAAGCCAGTGGAATTATCGTCAGATCGGGCTCAAGGTAATCGCCTCACGGATCCGG
TCTCGCCAGTGGACCAGACGGCCACAGGCACTTCCGACACTTCCTCGGGCACCCTGCAGCGACACTTAGAAGCTGCGATGAGTCGTTTCCTGGCCGAACA
GGGTATGAGAGCGCCCGTGCCACAAGTGCAAGTGCTCCACGAACATGGAGCACGAGACGTGGAGATGGCGTCCGTGGAGGGAGACAACTCCCATGATAAG
TTCGACCCAGATGATCTGGATGGCCCATCCACTTCGTCAGCAGTGGTAGCAACAGCCACAGCCGGGGCAGGTGGATCGTCCATGATCCAGAGGGTACGGA
TCTCAGCCATATCGGATCTGAAGGAGTTCACGGGCAAGGATCAAGATGAGGACCGAGCGAGAACATGGATCAGCAAAGTCAAGTCGGCCCTCATGAGAGA
TCAAGCGTCGGATGCTGAGAAGTGTTTGACCTTTGCGGATCTGTTAGCGGGGCCAGCCAGGAACTAGTATCGGCAGCTGGGCAGATCCACCAGGAACAAG
TGGCCAGATTTGCTGCGCAGTTTCCAGACCCAGTACTGTGGATTGGGAGTGTCGGTGGCACGACAGTACTACCACGCTCGCCGCAGATCGGATGAATCCC
CGCTAGAATACCTACATCGACTAAATGTGGCCGGT