Description :
From Genome Similarity Track
Location :
Scaffold_2240:343- 1944
Transcript NameFunction/comments
Phyta_totarag14279hypothetical protein

Sequence
1601 bases(100 bases per row)
GCTCGACTCCacttgtcttcgtcatctgTTGACCGATCTCCACCATTCTTGACCACTTCTGGCGTCGAATCTAGTTTCGATCTGCGTGCGATCTCATAGA
AATCGGCTTCTCGGAGCTCGTATAGGACCGACGCGTAGATCGCGAAGTCCTAAATGAAGCGACTGTAAAAACAAAATTGAGACTCCTCCAAaacgactgc
atcgatctCAGCGTAGTCGGTAAAGGTAGATCGGTCAGCGACAGCAGGTCCTTCGGGTGAGGTTCCAGTCCGTCCGCGGACACCTGATGGCCCAGNGAGG
ATGTCGTCAATATAAGATCGACACCCTAGCACCGACGATTCCTTTCCTTCGTCAGGTACTCCCTCCTCGAATACGTCGGTCTAGTTGGCGTGATCTTGAG
GAACCCATACAACGCATTGTCCACCAACCTCTGGTAGATCTGCGGCACGTTCTTCAACCTAAACGACATTCGATTCCATTCGAATAATCCGAAAACGCCG
GGATCGCGCGCGCTCTATCAGTCATAGACACCACCCAAAATTCACTAGCCATGTCCAACGAGCAATACCAGATGAGCTTGTCAAGATCGTCGAGTAGATC
GTTGATAAGCGGCATAGGGTACACCATTAGTCGAGTCAGGTTGATCAGGTGGTAGTCGATACAGAGTCTCATGTCGACTCcattcttcttgatgatTACG
ACGATCGGAGATGCCCATGGCGAGGTCGAGTGCCGGATGATCTTAGCTAATAGTATTCCTTTGATTAGCTGGAACAGCTTCTCACGGAACTGCGAAGCGA
CCTTGCGGACCCGTTGGGCTAATGGTCTTGCATTTTCCACATCAATGTCGCAAATCCCTCCCTTCGCATCAGATGACAAGGCGTTCCCCTTCCCAATTAG
AAGGTGTCAGCGACGCCAGTTGATCTTCACTAGtcgctcgatctcttccgCGTACTGTCCTCAGGGTTTCCCACTTGGATATCCTCGATCTTGACTTCTt
ccgtcgtcgacgtgaCCTCCGGCAATACCGCCATGTGACCCTCGAGATNCTCAGGGTTTTCTCCAATCCCTGCAAGTCGATCTTGAATGCGTTTCTGATT
TCCACCCATCTCTGCACCTCGATCTCGGCAATCACTTGAATCCTGACATCTACAATCACCTGAACCCTGACACTTGAATGCTGACATCTGCAGTCTTCTG
CATACATCGCCCTTTCTGCATCCGATACTGGGCGCTTGGTACACTCATCGGTGCTGACTTGTACATTCCCAGCCGGTGACAGGCCCGCGTTTCTTCCGTC
GTTGAGGCGCCTTCTCACAGAATCCTTTGGTCGTGTTCTCCGCCATCTCTGtcgtcgccaccgccgaGCTCTGCCACGTTTTGGCGGTCGCTCCAGCGGC
CGGGGCAAGATCGCAGTCGGTGTCTTGTACTGTGGCCGATCTACGGCAGGCTCCTGTGGCTCCTCAATTTTCTGGCGATCTTCATCGACATCCATCGCCG
CCTTGGTAGGCCAGGCTCTGCCATTCAGCATACCTGCGCGATCCCACCGAGATATATCCAAGTAAGCGTGGCACTCGATCTCCGGCCAGCCACATTCCAA
C