Description :
From Genome Similarity Track
Location :
contig_49:342948- 344345
Transcript NameFunction/comments
g9752.t1hypothetical protein

Sequence
1397 bases(100 bases per row)
TACCAGCTTGAAGGCCTTAACTGGCTTACGTTTTGCTGGTACAACCGTCGCAATTGTATTTTGGCCGACGAGATGGGTCTGGGTAAGACTGTTCAAGCAA
CTTCTATCCTCGAGCATTTGCGTCAACGAGAGTTTATCCGTGGACCGTTCCTAGTCGTAGCTCCGCTTGCTACGCTGGGTAACTGGAAGCGAGAGATTGA
AACGTGGACTTCGATGAACTGTGTTGTGTATCATGACTCAGAGGGAGGATCTGATATCCGTGCTTTCATTCGTGAACAAGAGTTCCACTTTGCGAGCGAA
GCTCATCGCAGACGCGGGATTTACAAGTTTAATGTTTTGGTCACATCATACCAGACGCTGATGATGGATGCAGAGTTTCTCGACTCCATTCATTGGCGGT
ACATTGTTATCGACGAAGCACACAAGCTGAAAAACCGCGAGGCCAAGCTTCTCCAGGTGCTCCATGGTTTTACTTGGGATTCATGTTTACTGATGACGGG
CACGCCGCTGCAGAATGGTGTGTTCGAGCTTTGGTGTTTACTGAACTTCATTGAGCCCGATAAATTCCCAAGTCAGCAGGAGTTTTACGATGAATTTGGC
GATCTAAATACTGCAGAACAAGTTGCGCAGCTGCATGAACAGTTGAGACCGTACATGCTGCGTCGTGTGAAGGAGGATGTTGAGAAAAGCATTCCGCCGA
AAGAAGAGACGATCGTCGACGTGGAACTCACGACGATGCAGAAGAAGTACTACCGCGCCATCTTTGAGCGGAATCGCCAGTTTTTGAACATGGGTGCTAC
AGGCACTGTCGCCAATCTGGTCAACGTGGAAATGGAGCTACGCAAGTGCTGCAACCACCCGTTCTTAATTCGTGGAGTGGAGGATAAGGAGTGCGCCGCG
TTCGATGAGCAGCTTCGAATGAAGGTCTTAATCCAAGCAAGTGGGAAAACAGTGCTGCTCGACAAACTGCTGACAAAGTTCCGCCAGGAAAATAAGAAGG
TACTTATCTTCTCGCAATTCAAGATTATGCTGGACATTATTGAAGATATGTGCCAGCTACGAGGCTACAGCATGGAGCGCCTGGATGGATCTGTTCGCGG
AAACTCTCGTCAGGCTGCAATTGATCGATTCAATAGCCCGGATTCAAACACGTTCGCGTTCCTGCTGAGTACCCGCGCCGGTGGTGTTGGTATCAACCTG
ATCGCGGCATCTGTAGTGATTTTGTTCGATAGCGACTGGAACCCTCAGAACGATCTTCAAGCCGTCGCGCGTTGCCACCGTATCGGGCAAACACAGTCGG
TGAACATTTACCGTTTGGTGACAAAGAAAACGTACGAAGCGCAAATGTTTGAGATTGCGTCGAAGAAGCTCGGAATGCACCATGCTGTGTTTGAGAC