Description :
From Genome Similarity Track
Location :
contig_15:342873- 344901
Transcript NameFunction/comments
g4039.t1hypothetical protein

Sequence
2028 bases(100 bases per row)
CTATTATGATGACGATGCGGGCCCGCAAAGTCTCGGCATTCGTCTGTGCACTCGGACATTTCGAATGGCTTCGTATGCCGTTTGGATTGAAGAATGCACC
GATGATTTACCAACGAATGATTGACAATGCTCTGTGGGGTTTCGTCCAACCCAAAGGCGGCTGGCTCCACTTTCGGAGCTTATGCGAACGGCCGAAGCCC
ACGCCGAGGTTGCGCGGACAGGGGTGACCGACCCTTCATCGCGACGACTCGAGGAGTCAACAACTCGGTGACCAAATTCGAGGCCGACCGCGAATCCTCG
GTCACGCTTGACGCAGTGAATGGGTTAGTGAACAGCCCTGTTGCCGACATGTTCTCCACCGGAGAACCGGATGAATCCTCGTTGGTGCCAGTGTTCGACC
GACGGTCGTTTGTCGATGACATCTGTTTTGGGTCCGAGACTTTCGACGCGTGCCTGGAGACACTAGACCGACTGCTCCAACGGTTCACCGAATGTCGCAT
TAGTGTGAGCTTTACGAAGAGTATCTTCGTCCAGCCAAAGGTGGATTTCCTGTCACACGAAGTCTCTGCAGAAGGTATTCGAGCCGACACCAAGAAGATG
AAAGCAGTGACCGAGCTGCCATTCCCTGCTTCAAAAAAGGGGATGCAGTCTTTCCTCGGTGCGCTGAATTATTACAGTCGATTCATCCAGGACTTCGCAG
TGTATGGAGCAGCTTTGTATCAGTTGAAGGATGAAGACTTCACGCCTAGTGGCAGCCTCTCGGGCCAAACGAAGCTTCGCGCGCTCCAACAGAAGGTTGC
AGAGGCACCGATCCTCCGGCACTTTGACCGAGACAAGGAGGTGCATGTCACGTTATTCGCGAATGAGTGGGCATTGAGCTCCACTTTGATGCAATACCAT
GATGACAAGCTGCACCCGGTTCGATTTTGTGGCCGAGTCCTCAAGGACGCCGAGATGAACTACCACCCGGCCGAGAAGGAGGTCTTAGCGCTACTGCTGG
TGTTGAAAGTGTGCTACTCCCAGTTGGTGGGTCGGACCATCCACGTCTATACGCGTTTTTCGACGCTCGAATGGGTGCACAAATCCAAGACACTGTTCGG
TCGAGCGACCCACTTTGCGGTTATGTTGTCCCCGTGGCACCTGGTGGTCAACCGAGTCAAGGAACGCGATTGTACGTTTGCTCAGCTTCTCCAAGCTGGC
CTCACAAGCTTCGTGGAGTTGGAAGACTCGTTGGCCCCAGTTACACCGCCGACGAAAGGGTCACCTACTGCTCGTATGGACCCCCACTTGCTTTATGCCT
GCCTACCGAGGTCCTATACCGGATTTGTGATGTCGTTCGATGGTTCGGCCAAGACCGAAAAGAACGGTGGATATGGCAGTTGCTCGTGGATTTTGTGGAA
ATTACCAGAATGGACTGTAGTGACGGCTGCGAGTGCTTATCTCGAGACCACCACGGTAAACCTCGCTGAGTATGCTGGAATGAACAACGGCGTCTCAGCT
GCGCTCGAACATGGAGCCGAGGATTTAGTCATCGTGGGAGACTCGAGACTCGCAATCCAGCAGTCCCTAGGGGTGATGGCATGTCGAAAGGAGTCTCTGA
TGGTTCAACTGAATCGTCACCGAGAACTCACGACCAAGCTGCGGTCGGTGAAGTACTTGCACGTGGTCCGAGAATTCAACGCTGCAGCAGATTCGTTGGC
AAGCGAGGCTCTCAGCAGCAAAGAATCCAGCGTAGCTTCGACCGAGGCTAGGAAATTAGAATTGGTCGAGCTGAACCGGATCGGAGAGGTCATCTATGAA
CCCTCAGTACAGACCACGGCCGAAGAGAAACCGACAGTCAGCTTCGCCCGAGCCCAAGTAGCCCGTGGAATCTCCCGCGACAGATCTTTTTTCGACTTTG
TGCGGGACGAACCCGACTACCTAACTGCAACAACCAGACACCAAGCAAAAGCGAGGAAGAAACGAGTCCAGTTTGCAGATGAAACGTCGGTGATAGAGCC
GAATGGTACACTGAGCGAGACGAAGCGA