Description :
From Genome Similarity Track
Location :
Scaffold_57:34286- 36418
Sequence
2132 bases(100 bases per row)
GCCAAAGCGCAGGACAGTCCGACCGAGTCGCGTCGCGAGACGAGTAGCTCGCTTCACCAACTGTATTTCGACGTCCGCACCTCCAAGCAAAACCCCGTTG
AAGAGTTTCCGTCACACGCCGCGACGTGTTTGGCGGTGTCGACGAACGGACGGTTTGACTCCACCGATACGTGTTTACTGGAGCACAGCCCGACACGCGC
AGCGGACGAGGATGCTTCCGAAGGGGAGAAGACCTTGGAGCTGCATGCCGGCCGAGCTTCCCGACATGGATGCGCGCGCCGCGAGAACGACGTGACCTGG
AGAGGCTATACCGACGAACTAGATGCCAACTGCGGAAAGTGGCGACGCGACTTCTCACGTCAGCGAATCGGCCGTTATCGTCTTGGGGCGATCTATTTGC
GCGACGACGAGGGGCGGCTGAACCGAGCCCTGGTGGATGAGCGCCTTTAGTGGTGCGGTGAAAGTTGGCAGGGTGGCTGCCGACAGGAGGATAGGTGGAA
ATCCTCGACTTTGGGAATGGCCGGAGCGAGGGGTTGGATGAGGGAAGTGTGGAGGACCAGCCTGTTGCTGAAGATGGGAAGGCGGAGGGCCGTCTCATAA
AAGATGTGAAGAAGTGGGAAGAAACGAAGGAAAAGAACAAGAACCACGTGTTGGAGTTACGGCTACAACGACTACGTGCAACGACAACGTGGTGCACTAG
GGACCCCTCAATGGGGTCTATGTCAGTGAACGCGACGAGGGACGTCGCCGACGGCGACGCTTGGTCTGCGGGCAGCACGCTTGGGCGTCGCTGTCCGAGG
CCTCGGACTTGAACTCCGCTGTGACTTGACGCGCTCGATCGACAGCAGCAGCCGAATGCGACGCGACTGCAAGCCTTGGACGGCTGCGCTATCCGAAGCG
GTCATGTCGGCCGCTGTCAAAGGTCGCCGACTATGCCGCCGAGACGAAGGCGAAGACGATGGAGTCGAGACCGAACTGGGAGGCCTGCACGCTTGACGCG
TTGATTCCCCGGCTCCGCTGTACCGAGGTCGTCGGACACCCGCTGATGCTGGCGGCGGAGTAGACGCCGGACCTGGACGAAGCGTCGGACTTGGATGGTG
CGTCGGAACCCGATCAGTACCCGCGAATAACGAGGTATTAGCCTCAGGACCGAAAACGGGGGCGGCAGGACGAACGCTGGCGCCCGTACTCGACGTAGTG
GAGGCGAGACACGAGCAGCGGGAGCCGCCGCTCGGCTTGACTCCACAGGCCACAGTGTTCATCTCCACCGCGACGGAAGCTTCAAGTCGACTGATTAGGT
CGTAGGTGTCGATGTACCCGCCTAAGGACGTGACGACACCGGCAAGACGTTCTGGAAATCCATTGCGCACGTGCTACGCCATCTACTAACCTCGACGCGC
TTCCCGAAGCACTCGTTCTCAAACCGCGACATGCTCGTCGAGGTTCTGGATGGCCACGTCGCGCTCGTCTTCCAGCTCGATTACGTGAGCGCTGGGACGG
TGGACTTGAGCGTTCGCGGCCTCTCGCCGCTACCCCCACACGCGCCGTATTCCCAGCCGCGCCGCGCGGTATTGCGCCGCTCGAGACGTGGCCTGAAACT
CGACGATTCCTCCAAGTCGCGGATACGCGTCGCGCCCCGCCGGAGTTCTTCTACATAGGTCACAAGGAGCGCGTTAATGTGCCGAAGGTCTACTTTGAGC
GGCTCGTTAAACGCTGCGCCGACTCGGCTTCCGCAAGGCTCTTCGTGAGTGCATTACGAACAAGGGTGATATGCTCAACGAGGGTAGTGCGTCGCCGCAC
GAGCGCGATGGACCTGGTCTCTCTCGGTGACGGCGGTGTTGCACTCCTCTTTGGAGAGCCGAAGCTTGACGCACTTGGTCCCTCGCGACGCTGGAAGCGT
CGCGCGCGCGGTCGCGCTCGGCGAAATCTACGCCGCGTTGCTGTTCCGCAGCTACGAAGGATTGCTGTGCTTGATCACATTCGGCCATGGCAGCGCCGAG
TCGCGATTGGACCGGGGAGAGGCACTTTGGGCTACCGCGAGCTGATCGGACGGGTCAGGGAGGCGAGATCGATGAGCTCTGCTTGCATAGACGACGATTT
CGGCAGCCTCGAGGTCTCGGGCCCGCCCTCCT