Description :
From Genome Similarity Track
Location :
Scaffold_19:342734- 343982
Sequence
1248 bases(100 bases per row)
TTTGTGTGCATGCGTGGCTCCAACCGGTTAGGTGAGACACATCGGTTTTTTGATACGACGTGGCATAAGGCAACTTATGTTACTGCATACAGTCTGAGTG
AAGACATGCATTGGCCACCTCCAGTTATTAAGAGTGCAATGGTGCAGATTGCCTTATACTGACGCTTGTTGCTGACGATGGTCTTGTACGATCGTAGTAC
TCTCGCATGGTAGTCGATTACAGCGTTGATGATGTCATCTTTGCTTTTGTAATCAATGTTGCTAAAGAAATCTAGCAACATTGAGCTCTCGTTTCGGCCA
CCAGACTCAACGTCGGTATGCAAGTTGGAATGTGGGTCTTCATCTTCAATTGCACTCATCGGTATTGAATGACGCTGTACCACTGAGTAGGAGAATGGAA
AGTGAGGTGCGATCACATCCAAAAGCGCAAAAGTTTCATGGTAATTACTCTGTGTGCCCACCGATTTCTATCATGCGAGGTCACTGCTCAGTGTGTAGAA
ACTTCCCTGTAAGTGTGCATTTTCTGGAGAAGATTCTCCTCATATTGCAGCCTGATTGGATACGTATTTATCATCTTGCTGACACTGCAACGGTTAGATT
GCCATAATTTACCGTCATAAAACCAGCTTTCGTATTTTTCAACCTGATAGAGACAATTTCTTTATAAATGTTCGAAAAGAAACATTTTGTTTATTAGTGT
TTGAAATCGAAACATATTTTTTATTTTTCCTTAATTTTATTATAAAAACTAGGAACTGAGAAATTGACCCAGGCAAATTGCCGTAAGTCAAGATTTTGCG
AACACAACAAAAAGAGAGCCGCCAGATGGCAAACAGTGCCCGTAAACTGATCTGATAATTGGCCTTTTTATGATTTGTTGTTTTCTGAGCACACAGCCGT
CTGAAACAAATTGCAAAGATGTCAATACATGTATGAATTTTGAGCTAAATGACAGTATGTGTATGAATGTGCTCTGGGACGCATACTAAGGACTGGGTTA
CAATTAAGTTCCCAGGCGCACACATACAGACAATCATCTGACGCACTCGTACATAAACAGGCGCTAAAAATTGTTCAAAGATAGTCCAGCTAGTGAGGTT
GGTGGGGTGAAGAAAACTCGGGTCAATTCGGCAAAACGTAAAAGCAAGTCTAAACACTCACGCACCCACCCACCCCTCACAAACCCGCAAACAATGGAGA
GGTTAGAGGATACACATTCTGGCATTTTGCACGTGTCCAAGCATACAC