Description :
From Genome Similarity Track
Location :
contig_15:342725- 347502
Transcript NameFunction/comments
g4226.t1hypothetical protein

Sequence
4777 bases(100 bases per row)
ATCGTGATCGTGCTCAAGAAGAATGGAGTTGATATTCGGTTGTGCATCGACTACAAGCTGGTGAATGCAGTGACGGCGATTATGGAGTACGCCATGCCGT
TAGTCGACGACTTGTTGACCGACCTGGAAGCCTACCTATGGTTCTGCTCGCTTGATGCGGCCAGTGGATTCTGGGCTATTATGATGACGATGCGGGCCCG
CAAAGTCTCGGCATTCGTCTGTGCACTCGGACATTTCGAATGGCTTCGTATGCCGTTTGGATTGAAGAATGCACCGATGATTTACCAACGAATGATTGAC
AATGCTCTGTGGGGTTTCGTCCAACCCAAAGGCGGCTGGCTCCACTTTCGGAGCTTATGCGAACGGCCGAAGCCCACGCCGAGGTTGCGCGGACAGGGGT
GACCGACCCTTCATCGCGACGACTCGAGGAGTCAACAACTCGGTGACCAAATTCGAGGCCGACCGCGAATCCTCGGTCACGCTTGACGCAGTGAATGGGT
TAGTGAACAGCCCTGTTGCCGACATGTTCTCCACCGGAGAACCGGATGAATCCTCGTTGGTGCCAGTGTTCGACCGACGGTCGTTTGTCGATGACATCTG
TTTTGGGTCCGAGACTTTCGACGCGTGCCTGGAGACACTAGACCGACTGCTCCAACGGTTCACCGAATGTCGCATTAGTGTGAGCTTTACGAAGAGTATC
TTCGTCCAGCCAAAGGTGGATTTCCTGTCACACGAAGTCTCTGCAGAAGGTATTCGAGCCGACACCAAGAAGATGAAAGCAGTGACCGAGCTGCCATTCC
CTGCTTCAAAAAAGGGGATGCAGTCTTTCCTCGGTGCGCTGAATTATTACAGTCGATTCATCCAGGACTTCGCAGTGTATGGAGCAGCTTTGTATCAGTT
GAAGGACGAAGACTTCACGCCTAGTGGCAGCCTCTCGGGCCAAACGAAGCTTCGCGCGCTCCAACAGAAGGTTGCAGAGGCACCGATCCTCCGGCACTTT
GACCGAGACAAGGAGGTGCATGTCACGTTATTCGCGAATGAGTGGGCATTGAGCTCCACTTTGATGCAATACCATGATGACAAGCTGCACCCGGTTCGAT
TTTGTGGCCGAGTCCTCAAGGACGCCGAGATGAACTACCACCCGGCCGAGAAGGAGGTCTTAGCGCTACTGCTGGTGTTGAAAGTGTGCTACTCCCAGTT
GGTGGGTCGGACCATCCACGTCTATACGCGTTTTTCGACGCTCGAATGGGTGCACAAATCCAAGACACTGTTCGGTCGAGCGACCCACTTTGCGGTTATG
TTGTCCCCGTGGCACCTGGTGGTCAACCGAGTCAAGGAACGCGATTGTACGTTTGCTCAGCTTCTCCAAGCTGGCCTCACAAGCTTCGTGGAGTTGGAAG
ACTCGTTGGCCCCAGTTACACCGCCGACGAAAGGGTCACCTACTGCTCGTATGGACCCCCACTTGCTTTATGCCTGCCTACCGAGGTCCTATACCGGATT
TGTGATGTCGTTCGATGGTTCGGCCAAGACCGAAAAGAACGGTGGATATGGCAGTTGCTCGTGGATTTTGTGGAAATTACCAGAATGGACTGTAGTGACG
GCTGCGAGTGCTTATCTCGAGACCACCACGGTAAACCTCGCTGAGTATGCTGGAATGAACAACGGCGTCTCAGCTGCGCTCGAACATGGAGCCGAGGATT
TAGTCATCGTGGGAGACTCGAGACTCGCAATCCAGCAGTCCCTAGGGGTGATGGCATGTCGAAAGGAGTCTCTGATGGTTCAACTGAATCGTCACCGAGA
ACTCACGACCAAGCTGCGGTCGGTGAAGTACTTGCACGTGGTCCGAGAATTCAACGCTGCAGCAGATTCGTTGGCAAGCGAGGCTCTCAGCAGCAAAGAA
TCCAGCGTAGCTTCGACCGAGGCTAGGAAATTAGAATTGGTCGAGCTGAACCGGATCGGAGAGGTCATCTATGAACCCTCAGTACAGACCACGGCCGAAG
AGAAACCGACAGTCAGCTTCGCCCGAGCCCAAGTAGCCCGTGGAATCTCCCGCGACAGATCTTTTTTCGACTTTGTGCGGGACGAACCCGACTACCTAAC
TGCAACAACCAGACACCAAGCAAAAGCGAGGAAGAAACGAGTCCAGTTTGCAGATGAAACGTCGGTGATAGAGCCGAATGGTACACTGAGCGAGACGAAG
CGAATGGTGTGACCACCGAAGCTCAGAGTGAGCTGAGAGCCGAGCAATCGAGCAACGAGGTAGACCCTGGCGCTCCAAACGCAGAAGACGTTGACCCTGT
GGTTATACAGGAAGAGCGCCGGAGACGAATCTCCGCCGCCCAGGATGAAGAGCTGAGATGGTCGAACCTAAAAGCGGTCCTCCGAGGCAAGGAAACAGAC
CTCAGCTACAGAGCAGCCAGAGACGCTTGGAAGATGGCCGACAAGTTCGTGCTTAGCGAGGATGGTGTACTGTATTTTCTTGGAACGAACCGTCGGTGGG
GCAACGAACGCCGAGAGGAGACAACGATGCGTCTAGTGGTGCCCACAACGATGATTCAGGAAGTACTACGGAGTTGCCACGACTCGTTGGAAGGTGGCCA
CCAAGGTATCGGTCGAACGTACCACCGAGTCAAATCAGACTATTTTTGGATTGGACTATATGCAGACGCCGAACGACACGTCAAGTCCTGCCCCGACTGT
AGTTCGAGCAAAAGTCGACCACAGTTCCGAGGCTATTCGCCAGGAAATGTCTTAGCAGAGCGACCGTTCCAGATGGTGTCGATGGATTTCGTCATACCGT
TACCGAAGTCTCGTCGGGGCAACTCAGCCCTACTACTGTTCCAGTGCGCGTTCACAGGATTCGTCATGGGTAAAGCTATGTCAGACACTACCGCTCTGAG
GGTCGCACAGGCTTTCGAGGAATGCGTGTACCGAAGATTCGGAGCACCAACTCTGATCCGACATGACCGAGACCCTCGCTTCATGAGCGAGGTGTTCCAG
GCCTTTGCAGAAATGATGCAGTCTCGGTCAAGAGCGACCCTGAGCTATCGGCCGCAGGCGAACGGACAGCAAGAGAGGTCGGTGAAGACGGTCATGCAAT
CGGTGCGGGTGTACGCAGAAGACCCGCTGCAGCAAGACTGGGACGAGATCGCGGAGCGATTGATCTTCGCTATCAACAACTCTCAAGATGGCACCCGGAA
GGACACTCCGTTTTACCTAGTTCATGGGTGGGACGCACAATCCACGCTGCGAGCGATGTCGTCGTCACTCAAACGAGGATTCGGAGGCCAGACTGACGCA
TTGGCATGGCGCCGAGAAGTGAACCGGCAACAGGAAATCTCGTGGAAAATGGCAATGGAGTACCAAAGTGTCGAGAAAGCTCGGAGGGCGAGAGAACACA
ATGAGTCGCTGGAGCGACGTGAGAGAGCTGCAGTACCGAATGTCGACGAAAACGAGACTTCTGACGAGTCACAGGTGGAGACGGGGGCAACATCTGATCC
CACTGTCGAAGGACCGAGGTCTCTGTTCCAACCCGGAAGCAGAGTTTGGTTGTATATGGAACGAGTCAAGCCAGGGTTGACCAAGAAACTCGCCCACCGA
TGGCATGGACCATTCAGGATCAAGAAAAAGATCGAAGAGTTTGCGTACGAGTTGGAACTGCCAGACCGAAGTGGGTATAGGTTCTACCCGGTGGTACACG
TGTCCCGACTCAAGGCCGTCAACGAATTTGGAGACCGACCGAAGAGTCGGTTAGCACCTGAAGTGACCGAGGATACGAGACTGGACTTCGATGAGGAGTT
GTTGCCTGAAGATAGCTGGGAGCCAGACCAGCTCGCTGGCGAATATGAGGTAGAAGCCATCCTCGATGACCGATCCCCGCTGTCGACGGGCACTAGCCGC
GCTGTCCGAGAGTTCAAGTGAAGTGGATTGGGTATGATGAGCCCACGTGGGAGCCTGCCTCAAATTTATCATGTGGCGGGCTACTTTATGATTATCTGCG
GACTCGGCGCAGCGAACGACGATTGCAGATGGTTCAAGTCGCTGACGAGAACTAATCTGGAGAGCTACCGAGAGTTGAACTGTCTACGGGGGTGATACAG
CCCGTAGCAACAGATGAAATTTGCTACTGTATCAAAATTGCGAGTGACCGACTATTGATTGCTACCAAGCCTCTGACGAGGCCTGGTTGCGACGTCGGTT
GACGAATGAACTGCCTGCGGGGATGATGCAGCCCGCAGTGACAGACGAAAACTGCTACTGCATCGAATTTGCATATTTACATGTGACGTGAACGATTTTC
GAATGGAATTGGATTAAATGGAATTACTTGGAGCTCAAGAACTGCCGCTACGGATGACTACGGGCTTCGGACGGCACACTGGCAGCTTGAGAAACGAACG
GAAAATTGGAGGGGGCCTGACCGAAGCCTAGACCTCAGTGGTCGACGCGATGTTGGCCAAAACATCCAGTCGACCCTTGAGCGGCCGACGTGTTGGTCGG
TGCTGGACCGGGAGTGACCAGGCGAAGATTCGGAGACGTCTTCATTTTCCTCCTGGCTCGGTCGAGCACCACCGACAGAAGCTGGGCAGCCCATGGAGCC
GTCACCATAGCCGACGACAACGAGGATCCACCATCAACCCGACACCACCTCCGCCTGAGTCATCCCTCGGGCACGAACAGGCACTGGGGTTGCACGGGCG
AACGTGGTGTTGAACGGGTGGCTAGCCGGCGCGTCGACCCAACAATTGCGCCACGGCTGCCTGTCGTCCAACGTGGC