Description :
From Genome Similarity Track
Location :
Scaffold_71:34268- 38074
Transcript NameFunction/comments
Phyke_g3277hypothetical protein PHYSODRAFT_522417

Sequence
3806 bases(100 bases per row)
CCGCGCTCGTGGCAACCACGCGGGCGGAAATCACGTTATCCAATGACCAGCTATGCCGTAAAAGCTCCATTTTGCGTGGTTTTGTGTCGGATCCCGCTAT
CGTGACGAAACGTATTTCGTTTGCGCAGTTGCATTTTTTGCGGCTACTTGCGAAAGGAGGTAGCGGTGAGGTTTGGCTTGGGCAGTATGAGACCCGCTAC
GTGGCTATGAAGTGTCTGCTTCCTACAAAACGGGAAGACCCAGAGGCATTGGAGCAGTTCGCAGAGGAGATTCGGATGGCCTCATTATTAGCACACCCAC
GCATCGTGGCCTTCTGTGGCGTGGCTTGGCAGTCGCTGTTGCATCTGTGTGCTGTGACTGAATTCATGGCTCGTGGCGATTTAGAAAGTCTGCTAtcacg
tccagcagctcaaaaggagttgagctggagaagagAGAAGCTCACACTTAGCAGTGACATCGTCGAGGCACTCGTGTATCTGCACTCGCTAGTGCCTATT
GTGATTCATCGTGATCTTAAGTccaagaacgtgctgctaGACAGGCGATTACGAGCCAAGCTGAGCGACTTTGGCCTGAGTCGCGAGCGATCCGTGGAGG
ATACAATGACAAACGGCATCGGCACTATCTTGTGGAGTGCCCCTGAGGTGCTAGAGGGCAAGAGATATGATGAGAAAAGCGATCTTTTTTCATTTGGTGT
CGTGTTGTCAGAGATCGATACTTGTGCGCTGCCGTACGGTTTTAGTCGTCACGCTAAAATGCGCAGTATGCAGATCGTCCATCTCGTATCAGAGggcaag
ttgctgccaaacTTCCGAGATGATTGTCCACCAGCGATACGTGCACTCGCACAACGATGTTTAAGTCTGGACCCTGCAGCACGGCCAACTGCAATGGAAG
TCGCATTCGAATTGCGTTCGTCCATTGCGCCACAGCTAATCCAGCAGTCAATACCGGCACtagctgatgatgcagccACTGACAGCATATCTTCGGCTTC
AGCTCCAAACCCTCAACAATCCTCATCCAGCATCGAAGGGAACGACGattcaacagcagtgccatcttcatcagtgcCACCACAGCCTTTAGATACTGAT
GTAGATGCCACTGCTTCACACACAAAGCAGACGCAAACTGATTCATGACCAAGCGAAAGTAGCTGACATTATTAAGAGCGCGAGTTAGAACTCGCAACCA
TTTAATTTATCAAACTTGAGACTAGACCCCACTCCTGCCAGCAATAGCTCGCCATGACATGAGCGAAACGGACCTTCTAGTGTGGACTTGAGCCGATTAG
TTTATGACCCGCGGGTGAGTTCGAATTAGGCGTTCTCCTCGTCAATGTCAAACGACCCCGCCAGTGATGAGGTTCTGTCGGCTTCCGAGGTAGTGCGTAA
GAGCCGCTTGATCCGCCGAATTCCGCTCCTGGTGAACctgatgaagcagcagctgtgtTCGGAAGGAGAATTAGTCCGAGCATTGGTACTCGCCACTTTT
GGCGACGGAGACTACATTTACTACCAGGGCCAGTCTGAGCGTGACTTATTGTTCATCGAAGAAGGAAAGGTTTTAATCACCCAACGACGACGGTGTCGCG
CCATGAGCACGGTTCGTGCAGGGCCTATAACTACGGAAAACCCATCAAGTGTTGTCTTCGCTCGGCGGCCTACACGACGGAGGTCCCAGGTAGAAGCTGA
GATGGAGATCCAGCTACACAAGCACGAGGAGCTTGAGTACTTTGGCGAAGAAACTTTATTGCAAGGAATGGCCTCCAGGGTGTTGAATGCCGTGGCTAGC
GGGTCTGTTACGTGTTTCACGCTTCCAGAGGTGGCCTTCGCTAAGCTGCTAGCGCCTGTACATGACTTGATGCTATATCGACATTTGCTTCGTATGCATG
GCGTGGTGGCCAAGCAGCGTATTTTTCAACACCTTTCAGCACGCCAGCGGCAGTACATTGTGGATAATTGTACTCTCGAACACTACGATGACGGAGCACG
GATTATACAGCAAGGCGACAAGGATGACGACCGCTATTTCATATTGGTTGAAGGTGAAGCTGAcatcgtgctggatgaaccTTTACAAGACATTGTGTGG
CCAGAAGGTGAAGTAGAACAGAGGTacgagctggacgaaaaTGGAGAGGACGTCAATGGAGGTGTGCGGACGTCGGTAGTGGGCCGCAAGACCCTTTATC
AAGGATTTGGTGAGATGGGAATCCTGTGTCGACCGCGAACTACCCATGTCATGGCAGTTGGAGACGTGTTGTGTGTGATTATCACGCGCAAAACATACAT
TGGAGCATCGCAATTGCTCGGGGTTGGCGGTCTGGATAGCGACGCTGAAGCGCTCCTCGCGATGTCTCTCTCGGAGGAATGGGCTCTTGTTGTCAAAACT
CGGAATTTGCATCTAGCTAACCCGTTAGTGTCGCACTATCTCGAAACCTTTGTCAAAAAGTTTAAAGCGGCCTACATGCAAAAGTTCGAAGGCAAGACAT
TGTACTTGGATCTACTGCGAAGGATACACACGGACCCAACACTTGCAGATGAATTTCCTTTTGTGTCTGACCGCGTGGCATGGGACTCGCCGACATCCTC
TCTCAGCATAGTGCGCGCTGAGACTCGACGTATACTATCGCTTCCCTCAGCCGAGCGCTCTCCATTTGAAATCAGTTTCATGGGTAGATTACTAGAGTCG
ACTGGCTTCATCGACAAATTTGACCGTCCTGTTCATGTGGACAAGCTCACACTTGCACGTGGTTTGGCTCGATTTGCCAACTTTTGCACAATCCAAAAGG
ACAAGTACTTGTTCCGTCAGGGAAAAATTGAGAGCCGTGCCTTCCTCATCTTGCGCGGCAATATCAGCATCGTGAACGAAGATATCAATGCAATCCAGAC
TGGCGTCGCTGTCAAGCACTATGATGTACTGGTTACACTCTCTGCTGGAGACTCGTTTGGCGAATTATCGCTTGTCACTCGACTGCAGCGTTCTGCAACT
GCTCTGGCCGCATGTGAAGCAGACTTATTGGTGTTTGAGCGCGCGCATTTGCAAGCATTGGCAGCAATTCAGCCCGGAGTATCAGTTCAACATGCGATGG
TCGAGCGCGCCGAATTTCTTGCTACACTGAGCTTCTTCCGCGACAGTGATTTCGCACAGTGTATTCGTGTGGCGCACGACGTCCAGGAACAATTTTACGA
GCCTCGCCACATTTTTTTGCAAGAGCCCATGCACTTACGCACACTTTACATTGTCAAGAGTGGTGAGGTTGTTGTCTTTCTACGACGAAATGTTCCCATA
GCAGAGTCAACCGCAACTTCGGGAACAAGCGACCCAGCCTCCACCAAAGAAGTACTCGTTCGAGTAGCAACCATAGGACCACAAGAGTTTTTCGGAGTCG
CCATTGCCAGCGCCAACATGATATCACCACCAACTTCCACTGCTACAGCGAGTAGCGGAGGTACTATCCCATCCCCTGCCAGCCCAAACACTGCTACTGG
GCCGCTATCACCATCGCCAGCTTCAGTATCACCAACATCGccagcttcctcatcatATCCAGCGAAAGCTCAGCACTACGTTGCAGCCACGTTagctgca
gctactgctggaaATGGGGTCATTTCACCCCCGACCACCAATTACGACCTTAGCACCACCGTTTTCATGTGCTCAACGCGTGTGCAGATACTAGAACTCT
CGGAGCGAGGTTGGAGGCGGTTGGCAATGTCAAGTTTGCAGAGTATCTGCAACTCCCTACTAGAACGCCACCGCTGGAACCTGGAAGCAgtcgagaagca
gcagca