Description :
From Genome Similarity Track
Location :
contig_37:342677- 343686
Transcript NameFunction/comments
g7621.t1HECT E3 ubiquitin ligase, putative

Sequence
1009 bases(100 bases per row)
GGCAGGTCCAGCCGGTTGAAACACGCGTAGCTGCGCACGAACTCGTCAGGCGCGCCGACGATACCCCGGATCGTGAACAGACACACCTTCCCGTCGTAGC
TGGTCAGTCCCTTGAAGCCCACGAGCGGCACGCGCGAGCATCCCGTCGTGAACTGCAACAAACGCCGGCGGTACTCGTTCGGCATTTCGCGCACGATCTC
CCAGAACCACAATAGCACCGGAGAGCGCGCGACGCTCTCGGCCACCGACGTGTTCTTCTCCCAGTCGTTCACGTCGATCTCGGGTGAGCCACACATAAGA
TAATCCAGCTCCTCGTAGTCAAACAGCAGTAGCAGCTGCTGCGGGATCACCTCGTAGATGCCCTTGAGGAACACGTACAGTTGATCAGCAACGCTTCGAA
GCAGCAAATGCTCGAATTTGCGCTCCAGATACTCGTGCTTGTTGGCGTCAGTCACTTCGATGTTGCGTCCATTTGGAATGAGGTCGACCGTCATGGTGCG
ATCGCCAACGGGCTCTAGTACGCTAAAGTCCAAGTCCAGCGCCTCCACGCCGTCGTTCTCCAGCATCCAAGACATGCTCTTGAACACGTCCGGGTCAAAA
TACTTTAGGTCGTCCAAGCACAACGGCGTGCCGAGAATGAGCTTCAACAGCGGAACGCACAAATGGAAATTCAACACCGTGCCCTCCAGCAGAGCGCGGC
CTAGAAGCCGCCCTGCCGCGTAATAGTAGATAAGATGTTCCTCGCCATTTTCGTAGCGGGAATTCGAATTCAGGAAGAAGGCTCGATCTTCCCCATTGGT
GGCCTTGAAGAGCCCCGCCCTCGGGTCTGTGAGCATCTCAGTAAGCATCATGAACCACTCGCGATGCAGTCCACCAGCGTCCACGCCGCTCTCTTCGAGG
AAGTTGATGCGCATAGCGGATCGAATATACTTCTCCTCTATGCATCCCAAGTGCTCCATGGATTCCTCAAACATGTAGTCTCGGTGAATGGAGAGCTTGA
GGAACTCCA