Description :
From Genome Similarity Track
Location :
Scaffold_24:34263- 41749
Transcript NameFunction/comments
Phyta_totarag1322mitochondrial-processing peptidase subunit beta
Phyta_totarag1323kinesin heavy chain, putative
Phyta_totarag1324conserved hypothetical protein

Sequence
7486 bases(100 bases per row)
CATACAACGAAGACACCGCGATATGTAGTCGATTCATTTTTCTTTCCATTCGTTCGTGTTTCTCCCCTGTAGCAAAGTGGCGTACGGCCCGTCCGCTTTA
CCATACAGAAAACTCACTGGTTATCTCGTTTCTCAGCCTCTATGCCTCATTCTCCCTTCTTGAAGACATCAGGATGCAGGGGCGATACGGCCCGCTCAGT
ATCGCAGCCAGTACGAGCGACGACGGATAAAGTTGTAGTccggcagctcgtggatAGGGCCAGTAGCAGCCAGAGCGTGCTCCTTGTCGTTCACGACCTC
ATCAGCTGTCTTgcggacagcagcggcgtccaCGGCGTCAATACGAGCGAAGACCTCTGCAGGGGTCATGCGGCGGCCGTACGTCAGCATCTGGCGACCG
ATATCCTCGCAGATCGGCGACGAGCCGTCCAGCTGCATCAGCATGTTGGCCTtcagctgcgtcttggcgcgctcaacctcctcgtccgtggTCTTGTGTA
CAAGACGCACCAGTGCCTCCATCGTGTACCACGTCAGGTCGTTGAGCTTGTACTTGTCACCAACAGCGTACACACCGAACAGACCCGTGTCCTGGTAGCA
CGTGTTGAAGGACATGTACGAGTGGGcgagctccttctcagcGACCACCTGGCccagcttcgacgacatGTTCATGCCGGCGCCCGAGGTGCGGTCCCAG
CTGCCGAGCAGCGTCTGCATGATCAGCAGAGGGAACGAGTGCTCGCTGGTCCAGCTGAAACCCTCGAAAGCAATGGCAACGTGGGCCAGAGGCATGCTGT
CGTCCTTGACGCGCACGTCCGAGCCGACGAAGCGCACAGGCTCAAGCGTGGGGGCAACAGCGGGGGTCGTGGGCAGGTCGCCGAACGACTTCTGGGCcaa
ctccaccagctgcgAGTGGTCCACAGCACCGGCACCGGCAATCACCATGCGCGGGGCCGTGTAGTGCGTGGCAATGTAATCCTGCAGGTCCGACTTCTTG
AGGTTACGGATCTACAGGTAGATACACATCAACATTAGTGAGTCAATTGGTCGGCTAGAACACAtcacttctgctgctatgACGTACGTTCTCAATGGGT
CCGAGGATGGTGCGGCCGAGGCCGTTGCCCATGAAGGCGGTCTCGTGCAGGCGGTCGAACACGacttcctcctgctgcttgttgacTTCCTCCATCTCGC
GGAGGATGACGTCGCGCTCCCGTTCGATGGcagcctcgtccagcttggaGTTCTGCAGGATGTCACTGAGGATGTCCATGGCGCGGGGCACGTCTTTCTT
GAAGACCTTGGCGTAGTACACGGTCTGCTCGCGGCTCGTGTAGGCGTTCAGGTGGCCGCCCATGTTCTCGatctcgagctccagctgctgctgcgtgcgc
ttGCTCGTGCCCTTGAAGGCCATGTGCTCCAGGAAGTGCGCGGCGCCGTTGTTCTGCGCCGTCTCGTAGCGGGAGCCGGCGCCGATCCACACGCCCACGG
TGGCCGTCTCGCCGTGCGAGCCCTCGGAGGCCACGCGCAGACCGCTGggcagcgtcgtcacctCGGTGGCCGGCGCGTTCAGCACGTACGACGGGTAGTT
GGACACGGCGGCTGCCACCGACGACTGCGCGCGGGCGAGCGGCTGGCGCACGAGGCTCAGCTTGGACATCATCTTCCTGACTTCTAGGGGGCGCTTTCTG
CTGTTCCAGGCTACGAATGAGAGACCACCAGTACGCGCTCAAGACCTCACGTTTGGTGGGAGCGATTTTCCGATTTTTTCAGATGGAATTGTGAAAAGTA
GAGATGCGTGAGCGCAAAGACGCTGGCCCCCCTTTTGCTCTCGACCCTCCAACACGAACCATACTGAATTCAAGCTGCGGAATTGAGGGTGAGGATGTAG
GATGGGAAGTGCAGCGCATATTTTGGAAAGCAGTATAGGAATTGCTCGGGAAATTAACGGAGAATGCTATCGATTCTGGTGGTTGGCGGAAAGCTCAGCT
TAAGAAATTGTTTTTGGACGAAGCATTGAACAGCACTTTCAAGCACAGAAGAAATGTGCGCGGATTGCTTCCTGCATTCCATCTCTGTCGACTCAGGCAT
TTTTTTTTGCTTTGCTGGAGACAGCGAATCTTAAAAAGCGAGGTTGGTGTGTGTGTAGATTTCGACGCTAGCGAGAGCCTCTGGGCTTACGTTCGACTCG
TAACTGACGACAGGAGCTCGTTCGCTTCGCAAGCTCAATTTGTGGTGTCCACAAGATTGGGAATATGCTAGCCACGGATACCATGAAGTTAGACGCGAGT
CAGTGGCGTCGTTGATGTTCCGAACAAAAATACAGAAGCACGATTCATCGACTCAAGCTAAGCCCAGATAGTGAACTGCTTGTAGTTTTGGCCGAGGCGC
TGTGTGTGTCAACAACAAGCCATAGACGAAATGTTTCCAGTGCAGTTGCCGATGTACTGCCAGTGGTATTTTGactgtgtacatgtagcagccATGACCT
AAATACTGATCGACTCGACACGCAGCAGATAATTGCCACTGTGGCAGTGGCCGTAAAGCAGTATCTTTTGAATGCCAATCAGCAGGCGTCGACTGGCGAG
GATCAGATCGGAATCAGATGGTATGTAGCCACATTGCCAAAATGTGACATTCATCACGTTGGGATTTCCTTTTGCAGAATCTATGGGATCTGCTGCGGAA
ACCCGCGCGGGCATCCGCGTGTGCGCGCGCTTCCGTCCGCAGAACAAACTGGAACAGAAGCACCAGGCTGTCGAATGCGTGCGTCTGGAAGACAATTCCG
CTGCCCACGTGCACAGCGAGGCACGCGGCGTGTCGGACGATCAcaccttcaccttcgacgagGTCTTCGGCACCCAGTCATCTCAGCTGGATGTATACAA
TGCGACGGCCAAGCCGCTGGTGGAGTCCGCCCTACGCGGCTACAATTGTACATGCTTCGTGTATGGGCAGACGGGGTCGGGCAAGACCTTCTCCATGGAG
GGCGTGCCAGGAGACAAGGACTACGAGGGCATCATCCCGCGCGTCATGGCCGACATCTTCGACGGCATCCAGAACATGCAGGCGGATCTCGAGTTCATCG
TGCGAGTCTCGTACATTGAGATTTACATGGAGAAGATCCGCGACCTGCTGAAACCTTCGTCTACAAATTTAAATGTTCGTGAGAGTCGTGAGCGCGGCGT
GTGGATTGCTGGTGCTACGGAGGTTTGTTGCGCCTCCGTGGAGGAAATACAGTCCGTGATGCGCTTGGGGGGGGCGAACCGAGTCATTTCATCAACAAGG
ATGAACAGTGAATCCAGTCGAAGCCactccgtcttcatcattaCCATTGAGCAGCGGAATACGGCGACGGGGTCGTTGAAGAGTGGCAAGTTGTTTCTGG
TGGACTTGGCAGGATCGGAAAAAGTGGGGAAGACTCATGCTCAGGGACAGACACTTAAGGAAGCGCAACACATTAACAAGTCACTTAGTGCTCTGGGGAG
TGTGATGAACGCACTTACGAGTGGCCATGCCAACACGCACATCCCATACCGCGACTCCAAGCTGACTCGGCTTCTGCAAGACTCACTTGGAGGTAACTCG
GAAACAACTCTTCTCGTCTGTGCCAGCTCCAGTAGCTACAACAGCGAGGAGACAGTGTCCACTCTACGATTTGGCACACGCGCAAAAAATATCAAGAACA
AGCCCAAGGTTAACGAAGAGCGAACTGTGGCAGAATACAAGGCGCTTGTAGCTGAGAAGGATAAGCGCATTGCCTCGCTGGAGGCTCGACTCCTTGAAAT
TAAAGACAATGATGTGAATGAACCAGCCAAGTCTACAGCAGATCAACAGTTGAAAATGTTTGCAGCAAAAGTGGAGGAACTTGAGGATGACCAGGCATCG
AAGGCAGCCGAAATTTCCAGTCTGGAAGGTCGGTGTGTCGAATTGGAAGAGAAAAACAAAATTCTCGAGGAAAAAGAGCGTGAGGTGGCTTCAATCATGA
GCCGAAACGAAGACTTCATGAAAAAGCTGGCGTTTTTGGAGATCGAGCTGGAGGCAAAGGCAAAAGAATGCGAAGAGCTGAATCAAATGCTAGAGAGACG
TCAGAGCAAGGCAAGCACGGCCGAGACGCCTCCATTATCGACTGCTAGCACGGTCGACAGCGAGGTTTCTGTGCAGGCAACGatcgaggaagacgatgag
cTGAATCCTGAACACCTCGAAGTGACATTGTCTTCAATTCCTGTGGTGGCAGAAAGATCACGCCCCAGCAGCTCGGTACTAGAAAATGagctccttcgcc
agcagctaGCTGCAAAAGCTCTTGAGCGTAAAAATTCCACGCAGCGTGTTGATGAACTCACGAAGGAATTAACCGACTGTCGCAGTGAATACGATGCTCA
GATAGAGATACTGCAAGATAAGCTGCGTGAGTATGATGTTCACGTCCGCGGTTTTGGAGACCAAGTTCCACAATTGGATTCGCTGGTTACTAAAacgaag
atgctgcgctctgttcgtggtggtggtcagCCCCCTGAGTTGGGTGGTCGATCAAATTCGCACGACACGAAGCCTCAAGCTCAACGTCAAGACAGTACTG
GATCAGCTATGTCGCAGAACCAGTGGAACTTGGATGACGAGATATTCCCAGTTGTGCCGATCGATATGGAGTCCGAGGTCGCCAAGCGCTTGATTCGGAA
TTTGCCCGAACGAAGCCGAGAAAAGATATCAAAATGGCTGGTATTCGTACTTGAAGGACGAGATATTCGTTCAAATTTCCATCCTGAGATCTCAATTGAA
GGTATCAACGAAGAGCTCAACCGGGATATGAGGCGATTGATCGTTCCTCTGCTGAAGAACCGCCACGATCTGAAGGTTCAGTCCTACGTCCGCACACGTT
ATGTTCTCGTCTCGGATTTAAAGATCTCGCTTGACCATAAGCACAAGGATGAAGTGCGGCTTGAAGCCACTGGTGATGACTCCGCTAGTGACGACGGCAC
TGCTGAAGGCACCTCTGACGCTCACAATTCGTCGTTCTTGTGGGCTAAAGACCACCTTTTTTACGGGCCCAAGAGTGACGCCTCCAGCCCATCGGTGCTC
CACGCTAATCGGGTGATCGTTCCGACGAAAGACAGGTTCACTTCTGTGCCTATAAACCTAAGTGCTAGCGTGACTGAGTCCAAGGCAATGTTGGAGCCGT
CGCACACAGCCCAGAAATTAAATAGGAAGCCATCACTTCCGTCCCGTGCTCCTGGATCCAGTCCAAGCAGCGGTGGAGTACTAAGTCGGCTTCGCGCAAA
GACAGGAGTGGGGTCCATGCTTGGCGACGTCAAGACACGTATCAATACTCGCTACCACAAGAACCACGTCCATGACGATGCGCTGTGCGATGGTTGTGGG
GTGAGCCCCATCGTCGGTGGGAAGTGGAAATGTAATACCTGCGAGAATTATGAGTTGTGCGATGGTTGCTACGCAGCAGGGATTCACGGCTTCGAAGTCA
GCAACGAGTTGTGTCGCCGCGTGGAGAAACTAGCCGTGCAGAAGCATCGTCTGCTTGGCGAGTACCCGGAGCTCTTTGAACTGTTCCGTCACCATATTTG
CCACGACAACGTCATCCAGTTCCGTCGTGTTGTGAAATGGCTCTGCGCAATTGTATCAGGGGCACGCTCACAAAAAGTCTACCACAAAATTATTGTAAAG
AGAGGACTCCACCCCGATATTCGTGCGCGGTTAGTGGCACAGCTCGGCGCATTGGCAAGCGAACGCACCAATATATCGCTGAAGACTGAGTGGTTTGCAG
AGAAGACGCTTGAGGAAGAGGCCGCCGACTCGGATTACAGTCCAGGATTCGACCCGATGGAGCCCGCACCTATCGTACTCGACGGGGACAAGTTATCGCC
AACGAAAGCCTTTACGCCGCCAACAGTTAGATTGGAGACGCTGCGAATGTATTTGATGGACACCGTTAGCTCACAGCAAGGCAATGAGTCTGGACCGGCA
CTCTCAGACTTGCTGGACCCATCGGGCAAGATGGACGGGCAGACCACCGACGCTGCATCACAGTCGTCTCGACAACCGACACTAAGGCGAACCATGAGCG
CCACAGAAGCGTACGCAGACGGCGATCACGACGAGCTGTTGgacagcgccagcagtcTCTGGACCTTCCAACGCACGGCCTGAACATGTAAGGGTGCAGC
TACTGGTACCCTCGGGAGTTTATGAGTGTGATGCGTACGTATTGAATGAAGATTCCGCTGGACTCAGCGCTACGGAACAAGGCTAAAATAAAGATTGCAT
TGAAATGCTACCAAATGTGACGGGCCATATTGGTGTGACTTTACCACCAGATTTCGTGATGAAATCTGGTGGTCGAGCGGCACACCATTGACCATTGGTG
GCCCACCAAGGGCCGAGGAAGCCTGCATGACTCATGTCTGCTTGGTGTTGGCTTCAAATCATTCTCCTAAATCACGTCTGCCGCAGACGGTCTACGTTCT
TTCTGCTTCGTCTATAGTCATTGGTGCGAAGCAACGCGGTGCCCATGGACACGAAGTTCGTGTCACGAACGCGTGCCGCTGACGAGTGACGACAGCAGCC
TTCGTACAACCACGCTCTGTCGGCGACAGCCGAGCATTCCTACACGGCTACTTCTACTGTACTGGAACGAGCTACGTCCTCCAAGAAACGCAATAGAGAA
ACTGATACATTTACCGGCAACCTGCCTTCCTAGCTCGTATCCCGTTTTATTCCTCCGGGATGCTGAGCAAATGCCGACGACGATATTGAAATGGGGGCTG
AAGAGTCTTCAGTGAAGACAACACGATGCAGTGAAAACTTCAGAGGCGCTAGGCGAAAGACGGCCAACCGACTGGATACGCAACGCGCCGCTTAAGGGCT
GGCCTTGCTGCACTGGGCCACgaactcgcgctgctgcgtggagaGGCCCCACACGGGCGCGCCCCGGATGATCAGCCGTTGGATaagcgtctcctcctcg
ctgGCGATCCGCGCGagtgccttcttctgctcctcgGCGGCGAGCGAGGACTTCTGCGCCTCCCACTGCttcatgagctgctgcagcttcgtcaagtCCT
GCGGCTCGGCGCGGGCGCCGGGGCTGAACTTGGAGCTGGCTTCAGAGCGCGTCTTCGCCGAGCCGTAGAAGCCGCCCTGGCCCTCGGAGGGCTGACCGCC
CGAGTACGTGGTGAGGGCGCGGGCGGAGCGCACGTGGCCAGCTGAGGCAGCGCGGCGGCAAGTCTTGAGTACGGTGGACTGCATTGTCTTGGAACGGAGT
TTCACGGACGTATCGGCAAAAATGGAAATGGCTGCCGTCTGGAGGTGCCCGTTGGCTCAGGATCTGACGTCGTCAAGATTCAAGAAAGATGGGATGTGTA
CGTGCGCTCCCGTGCACCAGAATTCCGTCGAATCACACCTTTTATGCACGATTTCCAGTCACGATTGGCCGGAAATGTGTCGACGC