Description :
From Genome Similarity Track
Location :
Scaffold_1130:3426- 6065
Sequence
2639 bases(100 bases per row)
TGTGACCAGTCGATCACGATCTTGGTCGACCGAAACTGAAGTCCAATGACAGCTACAAACCGACGTATCCAGCCCCAGCTGCGACGACGACAAAGGCCTC
GGTTGCGAGCCGACCGGCCAACACTTCATCGAAACCTCCGCCATCGCCATGTCCGAAGTGCAACCAGATGCATAACCTTCGAGATTGAACGAAGGCGACA
GAGCAGAAGAAGCACCGTATTTGACAGCGTCTTCGGGAAGCTAAAAGAATGAAGAAGGCTCGAACCAAGCGACTTGGTGGGTACGTGTCCGACCAAATGT
CGCTCAACAATGTGTTGCCCCGATAGTGGGTCGGTCTCTATAGGCACTTCTTTCGGGAAGGTATTGGCACGCCATCCGGGGGTCAATTTCAGGACGCAGA
CACAAGCGTCAAATGCGAGCTTCTTAATGCACTCGTCTGCAGCCGGATCTTCGGTTCACACTGGGCTAGAGCCGATAAGAAGCCCAAGTTGCATATGTAG
ATCCACACTACTGCCGGATAAGTGGAACCGATGGAACCTGTCTTGGGTGTCGATGTGAATGACAGCGAGTTCATTGTGATCTTCTGATGAGGCTCGGGAT
CAATGTGGAGCACAAGTTGGAGCGATTCACCATCCACGGTGATATAGAAGCTGCTGCTGATCCTGTTGAGCTGGAAGCCGACGAGCTGCCTGTCAACAGA
GACAGATCAGTAACCATTATTGGTGATGACACTTTAATGATGTGAAAAGCCTTATCGATCGAGCTGTGGAGAGCGGATTCCCTTTTGACGAAGTAGAACA
ACTAGAAACTATCCGTTACGCCTACGATTCGTAGAAACAGGAAATTGGCAATGTCCAGAAACCAACATACCGCCTCTCGTAATGCGTTTCCAGCATAAGC
CTCGATCTACCAAAGGTAAGCTCGCCCCCCCCCCCCCACACACACACATATATTCGAAGCTTCCAGCTAATCTTTAACAGGTTTGGGTCAATCTAGACTA
GACTTGGTGTATGAGAACCCACGCAGGCGATGGGAGGAGAGCCCCGTCTTGTCGGTCATGAAATCTATGAACCGATGGACCTACGACAGGCCGCATTCTC
AACGAGCAAACAGATGTGATGTCCGCCGTGATGTCCATTCTATCGCTAAAGTTTTGAAACTAGCACGTGCAATGAAACACGCTGGATTATTCGATCATCG
AGCGGTGTTTTGGCAGCTATGAACCATTTTGGATTCTTCAATATCTAAACGTTTTTAGCAGCTATGAACCACTTTGAATTCTTCAATATCGAAAGGGTAT
TGGCGGCTTCCCCTAGACGAAGTCTACGAAGCGTTTTTGCGTACATGACGGACGAGAAGTTCTTCATACAACAGCGAGTTCCATAAGGCAGCAGCGATGA
TGACATCTTCTACGATGCAGGAAGGTTTAAGCGTCTACTCTACTATAAATAATCCGGATCGATGACCAGCTATGATACGCTGATGACATCGATGTATACC
CCGCCGTTAGGTATGCTGATCCGATTCGGACTCAAGCTGAGCGCCAAAACGTCCGGCCTCTACGCGACCAAGTAAAATGATGAGTAAACTGGATCGATCA
AGATGGAGCACAACACCATCTGAAATGTATCAACACGTTAACGTTCATGTCGTACCCAAATAATGCTGACGAATTTCAACTGTTCAGTTTGACCATCAGC
ACAAGCGCGACACCGTCATAGACTACGCTTCACATGTGTCACCTTTTAAACTCGGCTTGACGCCTCCCTGGCAAGGCCACGAAGTGCTAGACTTGCTGTA
GCTGGTTTCGCGATAAACCCAACAATGAGGGGCGCTCGGCATCCTTCAAAAACAAGGAGAAGATCGGCAAAGCAGCCGCTCTCTAGCTTCCGATAATAAG
GCGACCACCTATCCGTTCACTGACGCTTCGGGCATCAATTGGGCCTCCGACCCGGGGAAAGCTGCTACCGACCAAAAATACAATCTGATCATATGCAGGA
GAGGGACATTCCCAGACAGCTAGCCAAACTGGAATGTTATCGAGAAGTAGGCGCTCCCGATGGTGAATGTGCGTGACAAGTTCGACTGTCTCCTGCTTAA
GGCCGCAGCCATTCAAGATGTACTGCGACCACAGGAGCTGATACACGTGTTTACACTACACGCGGAAGTGAAGAAACACGTACGTAGTAAGCTACTCCGA
TGGGTAATGAAACTGATGAACAACTGATACGTAATCGAGCACGAGCCGGTAACTGACACCATATGGACCGACTTGATTTCCAAATGGACAGGAAGACACG
CCGTGACCTCAGCTCTGACGTGACTGAAGGCTATGCGATCTTTGCGATCTTTGCGATCTTTGCGACCGGCTACCACTACGACTACAGTTGTATCTACATC
AGAGCCTGAGGACGCTGAGAAAGTCTGAAACGGAGTTGTACCTGTTTCCTACAGCCTTTTTGGTCAAATTTCCCGACTTTGAGAATGGGGTCGTTAAGCT
TATGGCTGGCAGAGAGAATATCCTGACTAGAGGAGAACGAGCAGCTGTAGTAAAACTTCTCCAGACCTCCGATACTGTGGCGACGGGACCGCAGGAGGAA
GGTGAAGATGCCCATCAGTCCTTTGCCGAAGCTGCGTTG