Description :
From Genome Similarity Track
Location :
Scaffold_16:34255- 36617
Transcript NameFunction/comments
Hyaar_Emoy2802896hypothetical protein

Sequence
2362 bases(100 bases per row)
GGGGTGTGGTTGCGTGGGAACTTTTCGTACGACCGACGGTTACTTGTGGCGCTCTCCTAGAGTCACCCTGATCTTCGTTGATGTCGCCTAGCCCAAATGT
GGATACTTGGTTTCCTTGTTCTTCTGACCACTTGATCACCTTGTTCTTCTGATCACTTGAGCCGTCTGAATATCTTGCCTTATTATGCTTGCTGCGTCCG
ATCGCGGGCTAACTTGAATGAGTATCTTTGTCCCTAGCCAAGCAATCTAGGGACAAACCTTGAGCAAACACGTGAGCAGTAATCCTTGAACGTCGTGTGT
CCACAAGTATTCCAGCCCGAAGGGATGCTGACGTGTGCCTTTTGTAGGAAAATCAATACTGTTTGCTATTAACCTATTAGGAGCTAGAAATACGCTTATG
CTTCTCTGTATCTCGGTTTCTGTTACGTCGTTCGCCCCCTGTCATCCATTTCCTGTGCTTGAAGTGGCCCACCTCAACCACCAGCATGACCGCTGGTCGT
CAACAGTAACCATGACCGCTGGTTATCAATAGTGACCATGACCGCTGGTCATAATCCATGACCATGACCGATGGTCACCCACCGTGAATGTTACCGATGA
TCATCGCCTGTGACCACGACTGATGACCTGTCAACTTTCCACCGTACCGTTGGAGATTTCCGGCGGTTAGTCCTAAGGCCTTCGTTACCGGTCCCACATG
TACCCATGATGTGAAATTTTGTGTCATGATGAATCATAAACTAGCTTAGATCTGCTAGGCGTTCCATGGCGGATGCGGTCATGGTCGACTAACTGACCCC
AGATTATAATAATTGTAAGTGGTAAATTCTACGTTCATTTTATATAGTGTAGGTTGTGTACACTAGATCTCAAAAGCAGCAGCTCTGTAACTTGAAAGTG
ACACTGTCTTGTTGAATGATATGAGTAATATGGTTATTAATCTAACAATTATTAAAACAGCTTTGTAGCTTGCAAGTTACTAAGTGCATCTTCAAATGAC
TGGGTAAAGTGGAAAAGGACTCATCAAATTTGAATGAAGATGATTATGTTGGTTGTTAGTCTAATTCTGCTTAATAGAAATTACATCCTATGTTTGTCCT
GGGAGGTCATCAAAGTCAAGTTGAGAGCGACAGCGCTTTCTTCTACGGTAGCTATCGTGCGTGAGACGCCTGCGTCGCTCCGTTTCCGTCACGATAGCGA
TCAGGCGGTTCTGGACGCGATTAAATTTCTCGCCATCAGTGTCTTGCAGCGGGTTAGTCACTATAAGGAAGCTAGTTAAACGCACGCATGCCTAAAAATA
TCATCATATAAATCATGTCCCCACCTGTACTTGTCCGCACAAATTCCTCATAACGTACTCAGCCGCCCAAAATAATTCTCTTCGCTGACCCTGTCGCTCA
ATATCTTGTCATTCTTACGCTCTTCGTTTGCATAAAGACGGCGTCTTGGGGGCGCTCCTATTGGATGTATAGCCTGTAGCTGCTGGGCAAGTCCTTAATA
CCCTTTATCCGCTAAGATCGCCCACTCTTGCAAGAGCTGAGCTTTCATTGGGCCGCAATCTTCAAGCGCTAGATCTTGACCAGTCTTAATATGCATCGTT
TGATGAAACTCGAGGTTGTGCCGTAAGACTTGGATGTCTGCGACGCTTACTTTTGCAAAATTCGTGCGGTTAATAGCGAAACCGCGAGGGTTCACTGGCA
CCACCAACTTCAGTCCATGTAGATCGTGCTTGCCGCTGTAAAACGGGTTCTGTTCGCCACTGTGACCAATAGGGCGGTTGCACTGCTGGAAAGTGACGTC
CGTGGCGTAAATCGCGCACGGAAAGTACATTCGGACGTCGCCAGAAACCGCATGTTATCTTCGTATGCTCTCTTTTCGACTTGTTCATCACACAGTTTGG
GGGCAGCGACGCGTAAATACTTCGAGATTTTTTGGATAAACGTAGGTGTGGCCACGTTGAACACACGCGCTGCTAGATTCCACATGCCTCCATTCTTGAA
CACGAGGAGCATCATGGAAAACACGTCCTCGGCGGCGAATTGCGAGCGCTTGCCACGACCCACGTTCCAACTGCGCGTCATGTGGTCGACCATACTTGAC
CAGATAGTGTTAACTCCCGCGGCGAGAAGTTTGTCATGGTACGGACTGCGTCTGCGCCGCCGTAATTAAGAAAGCGGTCGTAGATCGGCGAAGGAGAGCT
GTCCATGTCGTCTTCCACAGTGGCAATTGCGGAAAACTGGCGCAATTCTTCTTGGCGGTCGGCTGCTCGCTGGTCAATCATCTCGAGTGCTTGAAGAACT
TGGTCTTAGTCCGTCGCGGGGGTGTATGAACGAGACATGACTAAAGTGAAGTGATTGATGGG