Description :
From Genome Similarity Track
Location :
Scaffold_62:34254- 38321
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_62-snap-gene-0.28Cyclic nucleotide-binding domain containing protein

Sequence
4067 bases(100 bases per row)
GCCGGTGCCGGCGGGTGGCTCAGGACGCGGGAGCGCATGATGGACCCGAACCGCTTCATCTGGCGGTACTTGTGCAGGAACTGGCTGCCGCTGGGCACGA
TCTCGCTGCGTCCGGATGTGACGTTGCCCGGCGAAAGCTCCAAGTAGTCCTGGAGCGCCGCGAGCTTGTCTTCCAAGGTGGCGGCGGGCTTGGGCGTGAA
CCCCGTGTCCTCGCGAGGGTCCTTGTCCTGCTGCGGCTTGAGCCCCATGCGCGCGCAGATAAACTGGTGGAGTTTTGCGGCTTCAGCGCGGTCGTCATCC
ACATCTGTCGACGCAGATGCCCCTGCGGTAGCAGCCGTCAAATGACGCAGCTTGTTACGGTTGGGCGAAACAACCGCGGAGATGACAGACGACTCTCGCT
TCTCGCGGCGGTCCGGCTCGACCTGGACGCACCACTCGTACGCGTCCTCGAGATGCAGCAACTCGCCGACGGGGAGCACGCAGATGAGGGCATTGCGCAC
AGGCGGTGGCGCCAATGTGAGTGCGGACGCCATGGCGTCTGCCTCGGATGAAAAAAGTTGGTGCACACACAAGAATGGCTCTTCCGTGACGGCGTTGGTG
ATCTCCCGTTTAGAGAGCACGATGCTGGCCGTGGCGAACAATCGTGGCGTCTTGCGGTCAGCTGGTGTGGTCGAAGGTGGTAAATCTTCCTGTTCAGATT
GACTGTGGCATCGAGTTGCGGACGGTTCTTCCTCTTCCTCGTCCAGCGAGCAGACAGCCATCGGAATCGCCACCTTCTGGAAGGACGTGAAGATCGACGA
CGTGTCCCGAGCCTTGGATGAACTGCTTGCTGTCGACGTCGCTGAAGCGGCTCGGTCGTGCTTGGGGTCGTCGGCACGTTCGTTGTTACCTCTGGCCGGA
GGCGGCTGCCGACCAAATCGCTCGATCAGCTGCTGCTGGAGCTCTCCCTCGCTCGATTTCAGACGTGCGCCGTGCGGAGGCAAAGCGAATTTCTTCTTGG
CTACTACAAAGTGCTCGAGCATGTGTGGTGCTGCCGTCGTTGGGTCATTCGGATCGTCATCGTCAGTGAAGGTCGAGGGCATTGACATCAGCATATCGCT
GGCCTCCTGCGGCGAATGCACCGACCGAAGGATCTTGAACACCACCGGCGAGGTTGAGTCCACAGGTGGAGAATGCGGGAATGCAACAACCACGTAGTCT
CCGTCGCACAATTGCTCGATTGTTTCGGGCCGAGGACTAGTGCCGAGTCCCGCATGGTGATTCTCGGACTGAGGCTCTTTGGTGACTTCGGAGGTGTTGC
GAGTTCCTTGTCGCGCCTTTGGCTCAACCGGATGTGAGAAGATGAAGTTCTCCTGTAAGCACCGGTTCATCGAGTCGTTGGTGCCAGTGTCATCATCAGT
CCCGTCCGACCGCCGAGGGGTTGTCGCCAAGCTACCGCTGCCACTCGGCGCCGACACACTGGAGCGCGTCCGCCGCCCGTTTGGCTGTCGATTCGACGAC
TCGCTCGGCTGCACCGGCTGCTGGATCTGACTCCGACCGAAGTACGCGAGCGGATTACCCTCGTTGAGAATCGCGGCTTGGCGCCGCTGCTCCGCTGCCA
GCGTGTTCTCGAGTTGGCGTGCGCGTGCGGCACTTGGTGGCGCATCGGCGTTGAAGGTGCCGATGTATCGGCCCACGCTCGGGTCCGTCTCGCCCTTGGA
GAAGCATCGGTCGGCGGCTTCGTCGACCGGCGGCAAGAGCAAGAACTCGTTCGCGTCGACTAATGGCCGACAATGGACCGTGTCATTGACGGCGCCGCCG
CTGCGAGTGCGGGGTGTTGTCGTGGACGGCTTTCGGCTGACAGAAGGCGGTGAGAGCGATGCCATCAAGGATGAGAGGAGCATCGAGGGTTCTGGTTCAC
TCGGCGCCTGGTTTGAAGCCTTGGTTGTTGTGGGTCGTCTCTGTTGGTTCTCTTTGGATGCTGAAGTGGCAGTAATGCCTCGAGGTGTCGTTGCCGACAG
CCTCCGTTCGATCCGCTCGTGATCCACGTGCTCTCGGAGCACCTTCTTCTTGAGAGCCTCCCACTTGTTGGACTTGACAAAGCGATCGAGGTAGACGACC
GGCTCGGCACTCGCGTGGCTGGCGGTGCGCAGCGAGTCGCGTACCGTCCGCGAGAGACGGTGGAAGACGTCGTACTTGGACAGGATGAGCACCTCGACGG
GCGTGCTGGCCGTGACGGTGACGTCGCGGTAGGTGGCGTCGTTGAACGTCTCCCCACAGGCGCTGTTCACCACCAAAATCAGCTTCAAGCCACTCAAATA
GGGATCATCACAAGAGGAACGAGACTTACGCTTCGGCGCCAATCATGCGGAATCGGCCGATCCGCTCGACGACGACAGTGTGGGTGGTGTTGGACGACGG
ATCGACAACTTGCCGCTCGGCGATGAGCTCGCCGCGCACGACGAAGTAGATGTGCTGCGCCTTGTCGCCTTGACGGCAGAGCACGGCGCGGATGGCGAGT
TTCTGCTCGACAAGCACGTACGTGAGCTCCTTGATGAGCTCGGCGGTCCACTCGGGGGTCTGAAAGAGCGGGATCTGGTCGAGCACGGCCACGCGCTTGG
CCAGGTCCTTCTTCTGCAGGCGGCGCAGCGTGGCGTTGTAGTCCTTCTCACAGATGACGAGCAGCCTGCAGTCTTCTCGGGCGAGGACCGTGGCGCTGCG
CACGCCGCGGCCGTGGATGAGTGCGAGCTCGCCGAAGTGAGAACCTTCGGCCAGGCTGACGAGCTTGCTGCGCTGCGCGTGGCCGTGTGTGTCGGTGGAG
CTCGCGAGCACGTCGACGGATCCGCTGAAGATGATGTAGAAGAGGTCGCCGACCTCGCCCTCTCGGAAGACGGCGGCGCCGGCGGGGATCGCGAGCAGCT
CGACGACCGAGCAGAGCTCTCGCACGAAGGCGAGCGGCAGCGCGCGGAAGAACTTGAGCGTCGCGAGGTACTCGCTGAGCATGTCGACGTCGGCCTTGGA
GCGCGAGGCTCTCGGCTTGGCGAGCGCCTTGATGTACTCGCGCCGGGTCTGTGCCTTGGATCGCGGCGCGGACAACCCGTTGGTCATCTGGAGACGCGAG
AGGAACTCGAGCTGGTCGTTGCGGAGCAGCAGGTCGTAGTCCTTGCGTGTGATGCGCACGAGCTCGCTGGCCACCTTGGCGATGACTGTGGCGGCGCGCA
CGTCGTTCGTGAGCAGCGCACGCTCGNNNNNNNNNNCCGAAGTAGTCGCCGCGGCCCAGTTCGCCCACGGTCACCTCGACGAGCTCGCCGAGCACGCGCT
GGCTCACGCGCACCTCGACGACGCCGGAGAGCACGAGGAAGAGCGCGTCACCTTCGTCCCCCTGGCGGAAGACCACTTCGCCCGCGAGCAGCGGCACGCT
CGTCATGCGTCGGCAGAGCAGCTCGAGCTCCTGCGGCNNNNNNNNNNGCTCAAAGTCGGTCGAGAGCTGCAGCTTGGTGAGCTGGAACCAGGCCTTGAGC
GCCTGCACGTCGGCCGCCGACCGCGCCTCGCCGCTCTGCGCCAGCGCGCGCCGACATGACTCCTCCAGCAGCAGGTTGCGTCCGTACGCTGGCCGCAGTG
CTGGCGCCGGCACGGACGGCAGCGAGCCCAAGCCCTCGACGTCGTCGCTGACCTCGACCTCGCTCTGCTGCTCGAGCTGCTGCTGCTGGTTGCGCAGTGC
CGCTGCCTGCTGCCACTGCGCCATGACCGTCGACTGCTCGCTGTCCCCGACCAACTGCCGCGCCGCCACCGCCTGCGTCACCAAGTTCTTGACCTTGTGA
CTCCGCAGCAGCTGAGCCAGCGACAGGTTCTTCTGCCCACCGCCGCTGGTATCGACACTCCGAGTCTCGGTCTTGCGCACCTTGGACAGCACGGACGACC
ACGGGTCTGGGATGCCTGGTACGTCGGCGACTCGTCCAACGACCTGTTCGCCGTCGTCGCCGCGTTTGACTGCGCGCGCGCTGCTCTGCATGGCCATCAC
AGACCGCGCGGCCCGCGTCAGATCCATCTTGGCGCGTGTTGGCGGCGTTCCTGCATTCGATGGAGCT