Description :
From Genome Similarity Track
Location :
Scaffold_33:342521- 345289
Transcript NameFunction/comments
Phyci_574190conserved hypothetical protein

Sequence
2768 bases(100 bases per row)
CTCCTGTACCGTGCTTTTGCCGCCTTTGTCGCGAATAGACAAGAAGTATTAGAAACAAGAAGAAAAATGCGTACGGCAATTGACCGACTTGTCAATCATC
GTTTGAAAAGTGCAATCCAGCGATGGAGAGAAGTCGCTAAATTCTTGACGCGTTCCAACGCTGGCGTTGATGAGATATATGGAATCGGGAGTATTGGACT
ACTAAACGCGGCTCTCGGGCGTGATGACCTTATGCTAGAGGCTCAGCAACTGCTGCAACAGCTTCGAGTTACAGATGATTCGTTACAGCATATTCGCTGG
ACAAAGGAGCAGCAAGAAGCGGCAGAAGCCGAAAATCCAGCTTCTAACGATGACCTTGACCTTGAAAAGGCTCGAGAACGAGGCAAAAAATATTTTCCGT
ATCTACTGGAAGGTGATGCTAAGATGAATTTGCAAGACTATGAGGGAGCTCTTCAGCTTTATAATATTGTGTTTTACAGCGAAAAGTGGATGCAACAGAT
GGATGACGCGCAAAATGTGAAGTTGCAGCTGAAGATTGGCGAAGCTACATTCCGCCTCGAGAATTACGAGCAAGCATTAACAATATTTAATCACGCCTTA
ACCATAGCCAACCGAACAGGGTTGCGCTACGAAGAAGGATGTGCGGTTCTCCGCATTGCAGACACACAGCACGTGCTTCGATCCCTTCGAATGAGCATCG
ATAGTTATAAACGAGCTTTGCTATTGTTTGAAGCTGTTCGTGACGCGCAAGGTGAATTATCGTGCTATCGTGGGCTACAGCACGTATATGAGAGACTCGA
GGACAGAGAAATGATCGAAATTAACAAGCACCACGCAGACGAGATCGAGTTTGTCCTCTCAAATAAGCTGTCTTCGGCAGCACAGAAGATAAATAAGCTT
CAGCAGCGATTGGTTGGGGCAGGGGCTGAATCATCTTGTCAGATTACACTTGAGAGAGTAGGCCCCATTGTTCCGCGACTAAGAAGAGAACGCATTCAAC
GGAAGTTTGACATTCGAGAGGAAATTAAACTAGTGGCGAGGTTAGAGAAGTTACTAGCTGAGAAGAAAGCGTTGCTGGCAAAGGGAGAAGATGATCTCAA
GCGAGCTCTTGCCAGCGACTCCTCTCAAGTCGATTCAACAATAATTAACGGTTCTGATGCTCGCTACGATCTCGAAGATTTCAAGAAGAAGCTTGCCAAG
CTGATGGGAAGTGTAAAAGTTGGTGAGGAGCAGATTGGAAGAGAAATCACTAACGCAAAAATTCGTATTAGCAATGCTAAAGATGAAGTTAAAGGTCTTG
AAGAGGAGTTGGCGGTGGAGACGGGTGCACTCATGCGCAAAGTTTTGTCCAAAGAGAGAATGCGTAGCTTCAGTTTCAACGCAACAAACGAAGCTCTGAA
AAACGTGGTTGGAACTGCGAGCCACGGAGTTACAACTTGCTTTGCATCGGCTGGGGTGAATGGCTTCCTGTTTGACTTCCTGTCTGGAGCCTGCTTGGCG
CAGGCAGTAGGTGATCCGAACAAAAATCATCTTGGCGACCCCACTGGTCATCAAGCTCAAATATTGTGTGTGTATTATATTGGGCATCGCATTTACACTG
GATCTGTAGATGCTTCTCTGGGTGTTTGGGACGTGAAGAACGAGACAATCGGCGGGTTTTCATGTTCGCTAGTGCGTATACTAACAGATTTTGATGCTGC
CGTCGTAAGCGTCGTAGCTGATACACAGTGGCTTGCTTGTGGATGTTCTGACTGCGATGTATTCGTGTTCGACGTCGAAACATTGGCAACAATCGGCCAT
ATTATCTCAGCTCATGACCGTACTGTGACAACTTTGTCCATCCAGAGTGCCAATTCCGCGCTTACAACGGGAGCTGCTGACAACAAGATTAAGGTTTGGG
AGCTCGGAGAGGCGTCGCAATACACTACACGCAGGAAAGTGACATTAGTCTGGTGCCTCGAGGCAGAACGCCGGGGCGACGAATACTTCAATGGCCATCT
TGTTCCCATCACATGTGTTAGGCGCGTGGCGAACGAGATTGTAAGTGGAGACAGCGCTGGTCGAATCGTGATTTGGAACCTGGACGCAGACAACAAGCTA
CTCCGAATCTGCGATGTACATCGAGATGTTGAAGTGACGTGCCTTCAGTTTGATGCCACTCGAATTGTTAGTGGGTCGGGTAGTGGGCAAATTTGCGTGA
TTGACTTTGCCACCGGAAATCTAATCCAGACTTTGCACGGACACCAAGACAGTGTGCTAGATATTCAGTTTGATCGTACACGGCTAATGAGCATGTCAGC
TGATGGTAAATTGTTCCTGTGGTACTGGCAAACTCGTGATGGCATCGGTGCCGACCGAAAGAAGTATCATATCCTGGGCGCGGGTGAGACATTGCGCTCA
CTGTCCCTCATGTACCGCACCAGCATTCAAAAACTTCTCCAATGGAACTCGATCCCAGATTCGACGAAGACTTATCTCGGTCAGAAGCTAGTAGTCGAAG
TAGACGCCAACGCTAGCGCCTCAGACGAGCTGAAGACGCTGGACCTCTCAAGTTCGGTTCAATTTGGCAAGCTGTCCTATGAAAACCTTGACTTTGTCAC
CACAAACAAAAACAATAGCAAAGACGTTGAGTCGCAATGGGCTGCCCAACGCCTTGCAATGCTCGCAAAGGAATACTTCCCAGCCTTGGAGGACGAAGAT
AAGACAGGTGAAGTTGCTCCTCACGAAGAGGAAGAAGATGCTTCTGATGCCGATGTGGCTATGGATTT