Description :
From Genome Similarity Track
Location :
Scaffold_197:34252- 35469
Sequence
1217 bases(100 bases per row)
AGTGGCAACAAGCACTTGATTTGGAGTATCAGTCCTTACTGGAAAACGGAGCGTGGAAGCTCACTAGATTACCACCTGGACAAAAGGCACTGCCATGTCA
CTGGGTACTTGCGGTGAAGTACAATGCTGATGGAAGTAAAAAAGAGGTTTAAAGCGCGATTGGTTGCACAAGGAAACCATCAGGAATTTGGGGTAAATTG
CGATGAAGTGTATGCACCGGTAGCTCGGTTTGAGTCACTTCGACTCGTGTTGGCAATAGGAACCATATTGGATTGCCATATCCATCAGATGGATGTGCAC
ACGGCCTTTCTAAACGGGTCCATGGACGGAGAGCAAAAGGTGTATACGCACCAACCTCCGGGGTATAAGCAATCAGGCCATGAAGGGCTTGTTTGTGAGC
TTAAGAAGAGTATCTATGGGCTGAAGAAAGCACCAAAGATCTGGTACAATGTCCTCCACAGATTGTTTTACAGGACTTGGTTTTGTCCGATGCAATAAGG
AGTACTGCATCTATGTCCAAAAAGTGGGAGAGCAATGGATCATTGTGGTGGTCTATGTGGATGACCTAACAATTATGTCTCGTGACATGGGACTGATCAA
TCAGTTGAAGGCAGATCTACCTGGCAGATTTAAGATGAAAGATCTGGGTGACATTCATTATATACTAAAGATGGAAGTCCGTCGGAATAGGGAAAGAAAG
TCGATGACAATCTCCCAGCACAGCTATATCCTGGAGCTTTTGAAAAAGTTTAAGATGGAAGCGTGTGTACCAGTGTCAACTCCACAGATGAGAGGTGTGG
ATCTGGTAGCTGAGACGGAGATGTCGGCTCAGAAAATCTCAGCCCAAAAGTTTGATTTTCGGGGGCTTGTGGGGTCACTGCAGTATCTTGTGTGAGGAAC
CAGACCAGATATTGCAAACGCAGTCAGAGAACTGAGCAAATTTCTGTCGTGCTACAATGCAACACACTGACACGCAGCTAGGAGAGTGCTGAAATACTTG
AAAGGGACGTCAACGTACGGTCTACTTCTTTATGGAAATTCGAGAACGGTGACGTATGAAGTGTACACAGACGCAAGCTTCGCGTGTCAACCCAAAGAAC
GTAAATCAGTTACAGGGTATGTAATCTCCATGGCCTGGCAGCAGTGTCTCATGGTGTAGCAGTAAGCAAGGCTCAGTGTCTCTTTCTACTGCAGAGGCAG
AACTCATCGCGCTTAGC