Description :
From Genome Similarity Track
Location :
Scaffold_1076:3425- 9165
Transcript NameFunction/comments
g17226.t1hypothetical protein

Sequence
5740 bases(100 bases per row)
CAATTTTTTATACAGTAGCAAATTTCATCTGTTGCTACGGGCTGTATCACCCCCGTAGACAGTTCAACTCTCGGTAGCTTTCCAGATTAGTTCTCGTCAG
CGACTTGAACCATCTGCAATCGTCGTTCGCTGCGTCGAGTTCGCAGATAATCATAAAGTAGTCCACCACATGATAAATTTGAGGCAGGCTCCCACGTGGG
CTCATCATACCCAATCCACTTCACTTTGACCTCTCGGACAGCACGGCTAGTGCCCGTCGACAGCGGGGATCGGTCATCGAGGATGGCTTCTACCTCATAT
TCGCCAGCGAGCTGGTCTGGCTCCCAGCTATCTTCAGGCAACAACTCCTCGTCGAAATCCAGTCTCGTATCCTCGGTCACTTCAGGTGCTAACCGACTCT
TCGGTCGGTCTCCAAATTCGTCGACGGCCTTGAGTCGGGACACGTGCACCACCGGGTAGAACCTATACCCACTTCGGTCTGGCAACTCCAACTCGTACGC
AAACTCTTCGATCTTTTTCTTGATCCTGAATGGTCCATGCCATCGGTGGGCGAGTTTCTTGGTCAACCCTGGCTTGACTCGTTCCATATACAACCAAACT
CTGCTTCCGGGTTGGAACAGAGACCTCGGCCCTTCGACAGTGGGATCAGATGTTGCCCCCGTCTCCACCTGTGACTCGTCAGAAGTCTCGTTTTCGTCGA
CATTCGGTACTGCAGCTCTCTCACGTCGCTCCAGCGACTCATTGTGTTCCCTCGCCCTCCGAGCTTTCTCGACACTTTGGTACTCCATTGCCATTTTCCA
CGAGATTTCCTGTTGCCGGTTCACTTCTCGGCGCCATGCCAATGCGTCAGTCTGGCCTCCGAATCCTCGTTTGAGTGACGACGACATCGCTCGCAGCGTG
GATTGTGCGTCCCACCCATGGACTAGGTAAAACGGAGTGTCCTTCTGGGTGCCATCTTGAGAGTTGTTGATAGCGAAGATCAATCGCTCCGCGATCTCGT
CCCAGTCTTGCTGCAGCGGGTCTTCTGCGTACACCCGCACCGATTGCATGACCGTCTTCACCGACCTCTCTTGCTGTCCGTTCGCCTGCGGTCGATAGCT
CAGGGTCGCTCTTGACCGAGACTGCATCATTTCTGCAAAGGCCTGGAACACCTCGCTCATGAAGCGAGGGTCTCGGTCATGTCGGATCAGAGTTGGTGCT
CCGAATCTTCGATACACGCATTCCTCGAAAGCCTGTGCGACCCTCAGAGCGGTAGTGTCTGACATAGCTTTACCCATGACGAATCCTGTGAACGCGCACT
GGAACAGTAGTAGGGCTGAGTTGCCCCGACGAGACTTCGGTAACGGTATGACGAAATCCATCGACACCATCTGGAACGGTCGCTCTGCTAAGACATTTCC
TGGCGAATAGCCTCGGAACTGTGGTCGACTTTTGCTCGAACTACAGTCGGGGCAGGACTTGACGTGCCGTTCGGCGTCTGCATATAGTCCAATCCAAAAA
TAGTCTGATTTGACTCGGTGGTACGTTCGACCGATACCTTGGTGGCCACCTTCCAACGAGTCGTGGCAACTCCGTAGTACTTCCTGAATCATCGTTGTGG
GCACCACTAGACGCATCGTTGTCTCCTCTCGGCGTTCGTTGCCCCACCGACGGTTCGTTCCAAGAAAATACAGTACACCATCCTCGCTAAGCACAAACTT
GTCGGCCATCTTCCAAGCGTCTCTGGCTGCTCTGTAGCTGAGGTCTGTTTCCTTGCCTCGGAGGACCGCTTTTAGGTTCGACCATCTCAGCTCTTCATCC
TGGGCGGCGGAGATTCGTCTCCGGCGCTCTTCCTGTATAACCACAGGGTCAACGTCTTCTGCGTTTGGAGCGCCAGGGTCTACCTCATTGCTCGATTGCT
CGGCTCTCAGCTCACTCTGAGCTTCGGTGGTCACACCATTCGCTTCGTCTCGCTCAGCTGTACCATTTGGCTCTATCACCGACGTTTCATCTGCAAACTG
GACTCGTTTCTTCCTCGCTTTTGCTTGGTGTCTGGTTGTTGCAGTTAGGTAGTCGGGTTCGTCCCGCACAAAGTCGAAAAAAGATCTGTCGCGGGAGATT
CCACGGGCTACTTGGGCTCGGGCGAAGCTGACTGTCGGTTTCTCTTCGGCCGTGGTCTGTACTGAGGGTTCATAGATGACCTCTCCGATCCGGTTCAGCT
CGACCAATTCTAATTTCCTAGCCTCGGTCGAAGCTACGCTGGATTCTTTGCTGCTGAGAGCCTCGCTTGCCAACGAATCTGCTGCAGCGTTGAATTCTCG
GACCACGTGCAAGTACTTCACCGACCGCAGCTTGGTCGTGAGTTCTCGGTGACGATTCAGTTGAACCATCAGAGACTCCTTTCGACATGCCATCACCCCT
AGGGACTGCTGGATTGCGAGTCTCGAGTCTCCCACGATGACTAAATCCTCGGCTCCATGTTCGAGCGCAGCTGAGACGCCGTTGTTCATTCCAGCATACT
CAGCGAGGTTTACCGTGGTGGTCTCGAGATAAGCACTCGCAGCCGTCACTACAGTCCATTCTGGTAATTTCCACAAAATCCACGAGCAACTGCCATATCC
ACCGTTCTTTTCGGTCTTGGCCGAACCATCGAACGACATCACAAATCCGGTATAGGACCTCGGTAGGCAGGCATAAAGCAAGTGGGGGTCCATACGAGCA
GTAGGTGACCCTTTCGTCGGCGGTGTAACTGGGGCCAACGAGTCTTCCAACTCCACGAAGCTTGTGAGGCCAGCTTGGAGAAGCTGAGCAAACGTACAAT
CGCGTTCCTTGACTCGGTTGACCACCAGGTGCCACGGGGACAACATAACCGCAAAGTGGGTCGCTCGACCGAACAGTGTCTTGGATTTGTGCACCCATTC
GAGCGTCGAAAAACGCGTATAGACGTGGATGGTCTGACCCACCAACTGGGAGTAGCACACTTTCAACACCAGCAGTAGCGCTAAGACCTCCTTCTCGGCC
GGGTGGTAGTTCATCTCGGCGTCCTTGAGGACTCGGCCACAAAATCGAACCGGGTGCAGCTTGTCATCATGGTATTGCATCAAAGTGGAGCTCAATGCCC
ACTCATTCGCGAATAACGTGATATGCACCTCCTTGTCTCGGTCAAAGTGCCGAAGGATCGGTGCCTCTGCAACCTTCTGTTGGAGCGCGGCGAAGCTTCG
TTTGGCTGCCGAGAGGCTGCCACTAGGCGTGAAGTCTTCGTCCTTCAACTGGTACAAAGCTGCTCCATACACTGCGAAGTCCTGGATGAATCGACTGTAA
TAATTCAGCGCACCAAGGAAAGACTGCATCCCCTTTTTCGAAGCAGGGAATGGCAGCTCGGTCACTGCTTTCATCTTCTTGGTGTCGGCTCGAATACCTT
CTGCAGAGACTTCGTGTGACAGGAAATCCACCTTTGGCTGGACGAAGATGCTCTTCGTAAAGCTCACACTAATGCGACATTCGGTGAACCGTTGGAGCAG
ACGGTCTAACGTCTCCAGGCACGCGTCGAAAGTCGAATCTCGGACCCAAAACAGATATCATCGACAAACGACCGTCGGTCGAACACTGGCACCAACGAGG
ATTCATCCGGTTCTCCGGTGGAGAACATGTCGGCAACAGGGCTGTTCACTAACCCATTCACTGCGTCAAGCGTGACCGAGGATTCGCGGTCGGCCTCGAA
TTTGGTCACCCGAGTTGTTGACTCCTCGAGTCGTCGCGATGAAGGGTCGGTCACCCCTGTCCGCGCAACCTCGGCGTGGGCTTCGGCCTTACGCATAAGC
TCCGAAAAGTGGAGCCAGCCGCCTTTGGGTTGGACGAAACCCCACAGGGCATTGTCAATCATTCGTTGGTAAATCATCGGTGCATTCTTCAATCCAAACG
GCATACGAAGCCATTCGAAATGTCCGAGTGCACAGACGAATGCCGAGACTTTGCGGGCCCGCATCGTCATCATAATAGCCCAGAATCCACTGGCCGCATC
AAGTGAGCAGAACCATAGGTAGGCTTCCAGGTCGGTCAACAAGTCGTCGACTAACGGCATGGCGTACTCCATAATCGCCGTCACTGCATTCACCAGCTTG
TAGTCGATGCACAACCGAATATCAACTCCATTCTTCTTGAGCACGATCACGATGGGCGACGCCCATGGGCTGTCCGAAAATGCCACTAGACGAGCTTTCA
GCAAGCTTTTCAGAAGCTCGTACAGCTTCCGAAGGTGTCGGAGCGGTGTTCTCCGAGCTCTCTGTTTGATGGGTGGATGCCCCTGTACGTCAATATCGCA
CACCACACCGTAGGCCGGTGGTGGCAGAGCATTCCCACTCGCAATCATGATCTTCTCGTGTCGTTTCAGCACCGCAACGAGACTTTCTTGTTGACGGGCT
GTCGCTCTCGGGTTCAGAACATTCGGTCCTGAATAATCCAGTACCGTTTCCGAGGCTTCGGTCAGGTCCGGTAAGAACGCCAACTCGTGTGCATAGTCCG
TCAACTCGATCTCATTCGCTAAATGTTCGGACGTATTGGTATCGGTGTTCCCACTACCTGAACCGTCCCCCGCGGCAATCTCATGCATCATTGCTACGAA
GGCAGAGTCCAATCGGGTCTCCGGGTCATCACCGAGGACTGGGATGGAGTTCTCTTCACTCGTATACGTGGTATCCGCGCCATCAGAGGTGTCGGTCGCC
ACCGAGTCGTCATCTTCGTCGACCCATCTATCTCCAACAGGTTCGTCAGAGGGTTGCACCGAAGTCGTCAACGGCGTTCGGTCTCGTTCTGCCGGTTCCT
CAGTGCCCCTATTCGCGAACGTTATCTGGCCCTCGTCTAGGCCTTCCAAGTCGTCGGGTGGTCGAGGTAGGATGCCGCGAGGTGTCGGATAGTCTCGTCG
TTCTACAGCTGGTGGCTGATCTGCCAACCATCGTTCGTAGAGTTTGCGTTCCTGCGCGAACAAAGTCTCGTCTCGACACTCCGCATACGCCAGGACTTGC
CACTCCTCATACTTAGCGGAGTTCAAACGAGTGTATCCATCCCCTTGCGGCAGGTCACCCTTTTTCACCCACAGCAGTACCGATTCGTGTCTCGCGCAGT
GAGCAATCTTCGGCGACACGTTCGTTAGTCGCACCATCGTCGGCTGCCCTCGTCGAGACCTCGTTACAGTGGGCACCAGGTTTCCAATCCGGCGTGCCCA
CACGTCGTGAGTAGTCAGAGGCGGCCGTCGTCGTGGTAACCTAAATTCTCGCCACTCACGCCCTGGGACCGACAAATCTTCGGTCGGGCGTCCAGTCACT
TGCATGCTGTACGGCTCGGCCTCTGCTGGGTTCTGCGACTTCACCAGGGGCACCATTACCTCGTCCGGTAGTCTCGCAGTACCGTGGAACAGATCCAACC
GGACTCCGGCTGGAATCATGAAGTCCGTTCCCAGGACCACGTCCACTCCTGCACTGTGATCCATAACCCATACTTCAAATTCGTACACGCGCTCCCAGCC
TAGCGTGACTTTAACGAGTGCTCGTCTGCGGGTCTCCATCACCCCTGGGTTAATTCCTCGCACTTCCAGACTCCTACCGTGATCTGGAACTTCGCGCAAG
CGCAACCGTTTCGCGTATGACGCGGAAATCACACTGACATTCGCTCCAGTGTCCAGCAGAATCCTCGTTCGCGAGTCGTTTACAGTCCCATTGACGAGGG
CTCGCAATCGCTTCCTCTTGTCATAGCGCTGGGATGACCA