Description :
From Genome Similarity Track
Location :
Scaffold_252:3425- 4644
Transcript NameFunction/comments
Aphin_H310_14836Hypothetical protein

Sequence
1219 bases(100 bases per row)
CTGGAGCATCGACGGGTACTTGCTGCAGACCAACTCGGCCGACGGCGAGATCTTGTACTGGCAAGTCCACGGCGCGTCCGTCCGCCAGATTACTGACGGC
ATGCTGGTACGTGTTGGTTCTGCAACGAGAGCAGCTGACGCAAGTTGCAGATGCGCGATATTTTGTGGGACCGGTGGAGTTGCGTGTTTGGATGGCCTGT
GCAAGGTATTTGGGCAGACCACAGCGCGTGCAACGATGTGTCGGCGGTTTGCCTCGTGGACGTCGTTCCAACGTACAACCACCGACCTGCAGATGTGCAC
AACGTACTGGTTGCCGATCGCAGCCATCTTCGCGCATTCCGTTGGCCATGCATGAAGTCTGCGCAAAGCTACAACTACGATGGACATGCTGCCAACATTA
CATGCATCCTGACGTGGAAGCAGCACTATGTCGTCACCCTGGGTGGAGCCGACGGAACGATCATGGAGGTACGGAAGATGGTTTGAAAGGCTCGGTCCAA
CCGCGTGATGTGTAGTGGATGGCTGTCGCGAACGAACATAGGGAAGTCGACTCTATGCAGGAAGGGCGAGGCTGGAATGGCGAGGTCGATGCGATGGAGC
AGCAATACACAAGCAGGCCGATGGACAATGATGGAATTCCTGTGGACCAGCCATCCAGCCCGACACGGCCACCATCAGACAACATCCAACGACCAAGAAC
ACCACGACACACTTTCATCAAGGAGGGTGCAAATGATGTGACCCACCAGAGCGAGGAAAGCGTCCCAGATACCGAGCGAAACACTGACGACGTGGAAGTG
CGTGTGCCGCGGGACGAGATTCCTGCAAAGGAAGAGGCCATTCGTGAAGGAAGCACGACAGATGGCATCGAGTGTGGCCGCGCAAAGTTTTCATTTCAGG
GCGAACACCCCGACGAGCTCAACTTGAAGGAGGGAGAAGTTATTCGTATCTTGGAGAAGCGAGAAGGCGACTGGTGGTTTGGTGAGACTTGCGACGGAAC
GAGTGGCATCTTCCCACGGGAGTATGTGCAGATGGATTAGCAGACATCAGGGTGTCCAATCCATCCATGATGCAACCCCGTCGTCCCATGTCTCTGCTTG
TCGCGGGAAAGTTCCTTTGGTGTGGTGGGATTCAGACATCCGAAAATATTATCTTGCATGAATATAACAAACGTTCCGAATTAGGCTTTTTCGGTTAAAA
TTCGGATTTCTCTGTGTTT