Description :
From Genome Similarity Track
Location :
Scaffold_257:3425- 4535
Sequence
1110 bases(100 bases per row)
CTGCGTCCGTAGTTGTTTCCGGACCCTAAGCGAATACTCGAGCTTGATGGATCCAGGGCCTAGATCGTGGATCTGGCCGTAGGGTTGCCTTGCGGGTGAG
TTCCCTTGCCTTTGTGTTCTACTTTGCGTCGTACTTGCCGCCTCCTGTGACGGGATCTTGAGAGTTGAGATCTTCTTAGGTATACCCGGCCAAGTAGTCA
ATCCGGTTAACCTGTCGGATCTGCACGTGTAAAGGAAAACTCACTGGGTTGTAGGATCTGGCCAATGTATTATCCAGTTATCACTACCAACACTAGATTC
GCAATTCCCAACCTTCTCGGAGCTCGTACGGCCAATGTAGTTCCGGTTCTTGAGGGCAGGAAGGCACTTGCGTGTTATTGTGCAAATTGAAGTCTGTATT
GATACTTAAGCCTATACCTGCCTGGATTTCTACCTTCTATGTTGTTTACCTGTTAAATCCCTTGCCAGGCTCGGCTGCATGTTCTTTCTTTCCTTGGCCC
ATCATCCCAGCTGTATTATCTTCAGATCCACCGGATCCATGGCGTAATCAATATGGTCACCGTATTATGGGTACACACATCCGAATCCAGGTCGCTTGGA
TCCACTTCACTGTAAGGGTACACTCGTCATGGATCTGAGCTCTCCAATCATCCAACATCATCTTGAAACCGTCTGTGATCTCCATTGTCCCACGAAAGTT
CGAGGTCCACTGCATCCACCATCCCTGTATCCTGGATCGAGGTCCCTCTATGCGGAATCCTCACCTTCTGGGATCTGAACTCGGAAATGGAATCCGGGAC
ACCTCGCGGTGGATCTCGACTTCTCGTTAGTCGTGGATACTAGATCCACCTTCAGATGACACCTACCATCATTCCTTCATCGGATCCACACTCGATCCAC
CCGCATATAGCGTATCCCATATCCACCTAAGTGAATCCAGGTAAGGGTGGATCCGAGATAGGTCTTGGTGGATCTTGCCTTCCCGTACATCACTCATACC
AGATCCATCGTCGTCTCATACGGGGTGCTGCTCGTCATGGCTAATCCACCTCAGGCAACTTGAATCCGCGCCGGGCGATCCGAATCCTCTCTAATCACTT
GAAATTGTCA