Description :
From Genome Similarity Track
Location :
Scaffold_254:34238- 36040
Transcript NameFunction/comments
Phypl_g6024conserved hypothetical protein
Phypl_g6025serine hydrolase (FSH1)-like protein, putative

Sequence
1802 bases(100 bases per row)
CCGCCCAAGAAACTCCGCGTCTTGTGTCTGCACGGCTTCCGCACGAACCGCCAGGTGATGGAAAGCCAGACGCGCGGGCTGCGCGACGCCTTGGGCCCGC
ACGCCGAGTTCGTGTTCCTCAACGGGCCGTTCGAAGCCCGCGGGCCGAccgacgaggtcgtcgagCGCCTGTTCCGCGAGTCCGCGCCCTTCTACGAGTG
GTGGGCCGCCCGGTacctggagaaggaggagcgcgaggacatcgaggccgaggagggCGTACCGAGAGGCACCACCAAGCGCTGGTGCCTCGAGTTCGAG
GACATCGACCGGGCCATCGAGCACATGggcgagaagctcacggagctgggcgagttcGACCTGGCCGTGGGCTTCTCGCAGGGCGCCATCATGCTCACGA
TCCTGTCCATGTGGTAcctcaagaaggccaacaagcgctgGTGGAAGCTCGTGCTCTGCGTGTGCGGCGTGTACCCGCGCGGGATCAACGTCCGGGAGCT
GTTCGAGACCCACGAGGGGCTGCCGATCCTGGTGCCGGTCCCGTCCATCCACGTCGTTGGGCAGCAGGACGCGTTGTATGACGACTCGCTGGTGCTCAAA
GACATGTACACGGAGCACCCCAAGGGCAGCCCATTGCCGAGACTCTTGCTGGAACACGACGGCGGCCACAGGTTCCCCACGCCAACGCGACACGAGCAGT
TCTACGCGGACTTGGCGAGCGCCATTTGGCGGTTCTTCGAACACACGCGCCAGAGCTCCGCGGCAAGACTTTAGAAGAGCTGCTAGAGGACACAGCAATC
ACCAGAATAGTCGACGTACCATGTTCTTGTTAAACCAGACGCTGCCTTACTGTGTGTGCCCCATTTTGTGTACGTCATCATGCTTGAAGTTCGTCGTGGT
CTGCTCAGTCGACAttttgctgcgcttcagACACTCCACTCTATGGTGAGCGTCGCCGAGAACCTGCCTCGCCCCACGGCGCTGAGCCCGCCTCCCTTTG
AGGCCTCCAAGAAGATCCGCGTGCTATGCTTGCACGGGTTTCGCACCAACAAGCAGGTGATGATGGATCAGACTCGTGGCCTTCGAGCGGCTCTAGGGGA
TTCCGCGGACTTCGTGATGCTGAACGGCACGTACGAAGCCCGCGGGACGAGTGACCCGATGATCGAGAGTGCGTACAAGTCCAGCGCCCCATTCTACGAG
TGGTTCGAGAACCAACTGACCGACGGGTCTTCACTGCTGTACAACGACGCTGAGTCGTCCGCCAAGGCGCGGCTTCAAAGCGGCGCGGACCAAGGAGAAG
ACCACGCGTGGAGTCTATCCTACAAGGGCGTCGAGCAGTCCATGGCGAGGATCGACGAGGAACTCCGTCGCCACGGCCCGTTCGACGTCGCCATTGGGTT
CTCCCAGGGggcagcgctgctcacggTTCTGACGATGTGGTACCTTGGCCACGGCAACGTGCGGTGGTGGAAGCTGGTCATCTGCGTTGGGGGCGTGGAC
GTGAGTGCTGTCAATGTCAAGTCGCTGTTCCTGGACAAGTCGGGCAACCGCGTTCTCGTGCCGCTGCCTTCGATCCACCTCATAGGCAAGACGGACCCGC
TCTACCACGAGTCCCATCGATTGGCTTTGTCGTGGGCGGACAGAGCGGAGCCGAACGCTTTCAAGAAGCGAATCTACGTGCACGATGGCGGACACAAATT
CCCATCCGCGTCGAGAAACCGCGCGCTCTACGCAGAGTTGGGCCGTGTCATCAAGCTGCACTGCAACAAGGGAACGGAGGCGTGTACGGCCAGGATGTAA
AC