Description :
From Genome Similarity Track
Location :
Scaffold_433:3423- 7512
Sequence
4089 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNCTGAAAAGATCAAACAGCATACACCCCAGATGTCGAGAATAGAATCGGTCCGATCGCATCTCAGCTATGGACATTTTAATCCT
AAATATTTCGATCCCGATGATTTGGGGCAAGAAGAGCGGGAACATGCGTTGGTAGCCACCACAGAAACGTTTCAGAATGGTAGTGGAATTCTTCCACATA
TTCGTGTGTCAGCAATGACGAAGCTGAAAATATTTAGTGGCAAAGCCAGAGACGAAGATCGGGCTAGAAATTAAATCAGCAAGGTCAAGTAGGAGTTCCT
GCGCGATCAGGCGCCAGGCGAAGAAATATTTTGGTGTTTGGCAATCTGTTGATAGGGACAGCACGAAACTGGTACACCCAACTGATTCAATCTACACAGC
ACTAGTGGAAGCGATCGCTCGATAGTTTTATGATAAGTATGGATGGGAAGGTATAAATGTGGCCAGACAATATTATCTCCCACGGAAGCAATCAGATGAA
ACCCTGCTGTAGTACCTGTATAGCCGCAATGCTGCGGCTAAGCAGGCCAAGATCGCTCTCCGAGAAGATAAATTTGCTACATCGACCACACGTCCCGAAC
ATGTGGAGCACTTCATTGCTACTCTGGACAATCACGAACTGGAAAAACAGCTGACGCTACTGCGATTGATGGATATTGATGAGATGGAGGAAACTCTACG
TGCCTGCCAGAGGATAGAGACTCGCCAGATAAAAGCGTTATTGAATTGAGCAAATTCCATCAGCGGACGACCGCGTCTTCGAATATGATGTCGTTAAAGA
CAACTCGGGGGGGGGGGGGTGCGAGATATCCTTGAGAAAGTCGAAAGCAGTAGATTGGAGTTGGAGTCATATATTGTGATAAAGGCGTAGATCGTCGTCG
CGTTTGTGCGACATTTACACCCGACTAATACAAAATTGGACAGGAATCACCGCACCTGGCAGAAGAACATTGGTTGAGGGGATGATCACGATCGTAGTGG
ACGATCGAGGGCGCGTACCCATTGTATATCTACCAGACACGACGATCGAGGATGCTGGAAGAGATTGACATAATAGAAATGTGGTCGCAAAGTACATGCC
TCTGATCAATATTTCTTTTTGTGTGCAGCCTGCGGAGAGATAGACGAGGGTGGCAAATGGCCCATGAAATAAGTTTTGAATTTGATACGAAAATGCTAGG
AGCTTACGAATTTTGCTGGAGTGTTTACGCACACGGTGAAGGAGATGTTAAACTAGGACACTAACCAAGTTGGACTCTGGCACGAGCCAAGCGTTATAAG
CTTTGTATTTATGCATTTGTTAAAGGACAACAGAAGAATCAAGAGATGAACGATTGGATCAATCCGATCGCTAATATACAAGCTATTCTACATTGGTCCT
GTCAATCAAGTATAAAGAGAGTGAATGATTACGCCCGATCGCCTGTGTGGTGAAGCGGTCGAATGTAATCCTTACCAATCGCATCTTTTCACATCATGGG
TACTAGTATCGTTCCTCTTGAATACAGCCATTATCTGCCTTATCCTGTCCCAGTTTACCTTATCCCATATTACTCCACCCAAATTCGACTATCAACCACC
TTGGTCTGCCCCCGACATCTCCATCCGAATCAGCCATAAAATGCCTTAACATACCCCAGATTACTTCCCCCAAAGTTGTTCTTTCCATCATCGGTCAAAT
TTTGCCCAATCTCTGTGCAACTTCTTTCTTTCGATAGATTACATTTCAACTTCAACGGGGGTATAGGAACGTGGACATATCGGACATTGNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNGGATTCAGTGGTCAGAAGAACAAGGGTATAAGTATCCACATTTGGGCAAGGCGTCCTCAGGGAAGGTTAGGACGACTCTGGGAGAGCGCCACAAGTAA
CGGTTGGTCGTGTGAAGCATTTCCACGTGACCACCCCCCACCTACCCCCAACCCGGTCACGACAGACATCAATTTCAAGTCACCAAGAAGAGTGCAACCC
GCCCTCCGACATGTACATAAGGTGGGAAGGAACAAGACAAGACACACAGTTCGGAGTACCCCCTCCGTTAGCCGGTCTTCCGGGCTCCAGTAGGGAGATG
GGATCGCTCCGTGAAATGAGCGAATCCCACTCCACCGCAGATACTTGGAGGCATCTTCGGCTATGGTCCATGCTGGGAGTCTCCATACTATAGCACTACA
ACTCCACCTCCTTGCTTAGTACGGGCTGACCTATAAAACTCATTTACGTACAGCTCTTCGCTGGATCCTCGGTGGGGTAGGCAGGTCGATCGTCGGCATT
GCCTGCTTTGTAGGGGCAATAGTCGACAGTATTGAGTCTACACTCTCTCGAAGGGTAATACTGGCTGCCAACGCCCCCCCTCGCACCTGCTCTTCACTTT
TTTACACAGCTCACGAACTCCAAGGTCCACTGAGAGCGGCTCAATTTCCCAAGCGCCCCTTCAAATTGGCAGATTTTACTAATTTTGCTAATCGAATGTC
ATTTCAAGAACTCGAGGGGTTGGATGACCAACATGATGACACAGGTCTCCATTATGCGTAACAAGGCTAATACTTCTTTCTCCTCAGTACTGCCATATAT
TTGATTAGCCTTGAGGGTAATCTTATAAAAGTCACCGGCATAAGTAGTACTTCGTAATCCTGTACTTGTGACACCCAAATGTTCCATTC